Labshake search
Citations for Agilent :
201 - 250 of 1825 citations for N Furan 2 ylmethyl 3 bromo 4 fluoro benzamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Agilent/Dako, Z033429-2), Lectin (Vector Labs ...
-
bioRxiv - Systems Biology 2020Quote: ... pH 9 (Agilent, S236784-2) for 15 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... pH 9 (Agilent, #S236784-2) at 97 °C for 10 min ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli BL21 Rosetta 2 (Stratagene) by induction with 1 mM IPTG in 2X YT medium at 20°C overnight ...
-
bioRxiv - Physiology 2021Quote: ... DAB chromogen (Agilent, K346889-2) with hematoxylin counter stain (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: ... bluing buffer (Dako, CS70230-2) for 90 seconds and finally in Eosin Y (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... coli BL21 Rosetta 2 (Stratagene) using the plasmids described above by induction at OD600=0.8 with 1 mM IPTG in 2X YT (Streptavidin-GFP-GFP ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 2 mM glutamine (Agilent). Cells were allowed to attach at RT for 15 min and then transferred to a 37°C incubator without CO2 for 40 min ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 glutamine (Agilent #103579-100) in XF DMEM medium (Agilent #103575-100)] in atmospheric air at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Diaminobenzidine (Agilent, Cat#K346811-2) was used as a chromogen and finally ...
-
bioRxiv - Physiology 2023Quote: ... 2 μM of FCCP (Agilent), and 0.5 μM of rotenone AA (Agilent ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 9.0 (Agilent, S236784-2) for 10 minutes was used for MMP13 and p16 antigen retrieval ...
-
bioRxiv - Developmental Biology 2023Quote: ... Insulin (1:2, Dako IR002), Integrin-α6 (1:400 ...
-
bioRxiv - Physiology 2023Quote: ... and 2 mM pyruvate (Agilent) and the mitochondria concentration assessed by Pierce BCA Protein Assay (Thermo) ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-BCL-2 (Dako #M0887) and anti-β-actin (EMD Millipore #MAB1501) ...
-
bioRxiv - Neuroscience 2024Quote: ... Bluing Buffer (Agilent; CS70230-2) was applied to each tissue section until covered and incubated for 2 minutes at room temperature ...
-
bioRxiv - Genetics 2024Quote: ... high 9 (Agilent, K800421-2). Sections were immunostained in AutostainerLink 48 from Agilent with EnVision Detection System Peroxidase/DAB ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2 mM glutamine (Agilent)) ...
-
bioRxiv - Physiology 2024Quote: ... tissues were incubated with primary antibody over night at 4°C (guinea pig anti-insulin at 1:4, diluted in 1% goat serum/PBS, Agilent). This was followed by 1-hour incubation with fluorophore-conjugated secondary antibodies (Cy3-anti-guinea pig ...
-
bioRxiv - Cancer Biology 2024Quote: ... the sections were incubated with primary antibody (PRDX2, TFRC or 4-HNE) at 4°C overnight and followed by incubation with secondary antibody FLEX/HRP (Dako) at room temperature for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: PFDN5 ORF (splice variant alpha) was cloned EcoRI/SalI into pCMV-Tag 2A (N- terminal Flag tag, Agilent) or XhoI/EcoRI into pEGFP-C1 (N-terminal GFP tag ...
-
bioRxiv - Biochemistry 2021Quote: The second set of experiments was performed on Seahorse XF Cell Culture Microplates (Agilent, cat. n. 103022-100) with eight wells ...
-
bioRxiv - Microbiology 2024Quote: ... CH4 samples were analyzed immediately by flame ionization detection gas chromatography (Agilent 6890 N with Porapak Q column). The wetlands that were sampled in both experiments have no known prior history of agricultural use but are affected by runoff from surrounding agricultural and urban areas ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 4 was protein blocking (Background Sniper, Dako Protein Block or Normal block ...
-
bioRxiv - Cell Biology 2024Quote: ... and anti-insulin antibody (Dako IR002; 1:4). Highly cross-adsorbed Alexa Fluor secondary antibodies (ThermoFisher ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2024Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Microbiology 2024Quote: ... connected to a BioTek BioStack 3 microplate stacker (Agilent Technologies).
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cell Biology 2020Quote: ... and a mix of rotenone/antimycin A (stock solution 50 μM) (cat n. 103015-100, Agilent, Santa Clara, USA). Crystal violet was purchased from Sigma-Aldrich (cat n ...
-
bioRxiv - Bioengineering 2020Quote: ... The PHA monomers’ methylesters were assayed by GC using a Hewlett-Packard 6890 N chromatograph equipped with a HP-Innowax capillary column (30 m × 0.25 mm, 0.50-μm film thickness; Agilent Technologies) and a flame ionization detector (FID) ...
-
bioRxiv - Biochemistry 2020Quote: Nhp6 was expressed as a N-terminal 6x His-tag fusion protein in E.coli BL21-CodonPlus (DE3)-RIL cells (Agilent). A colony of cells freshly transformed with plasmid p1035 was grown in 3 L of LB supplemented with 50 μg/mL ampicillin and 34 μg/mL chloramphenicol at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... After calibrating and verifying the performance of the column using the LC Bio-standard (Agilent, P/N : 5190-9417), the recombinant antibody samples were diluted to 2mg/ml in 1XPBS and loaded onto a pre-conditioned column at a flow rate of 0.35ml/min ...
-
bioRxiv - Immunology 2022Quote: ... The final set of nucleotide sequences was collapsed at 100% nucleotide sequence identity (n = 238,068) and then ordered from Agilent Technologies.
-
bioRxiv - Immunology 2023Quote: ZIKV NS2B-NS3pro recombinant constructs with N-terminal His tag were used to transform competent E.coli BL21 (DE3) Codon Plus cells (Stratagene). Transformed cells were grown at 30°C in LB broth containing carbenicillin (0.1 mg/ml) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Horseradish peroxidase (HRP)-conjugated secondary antibodies were from Dako (cat # P026002-2 and cat # P021702-2) and detected using either SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM Sodium Pyruvate (Agilent, 103578), and 1 mM Glutamine (ThermoFisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... PECAM1/CD31 (Agilent Technologies, M082329-2), PECAM1/CD31 (R&D Systems ...
-
bioRxiv - Neuroscience 2020Quote: ... Hematoxylin (Agilent Technologies; Cat S330930-2) was pipetted onto each section until completely covered and incubated for 7 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... High pH (Agilent DAKO, K800421-2). 1X EnVision FLEX Wash Buffer (Agilent DAKO ...
-
bioRxiv - Immunology 2022Quote: ... CD3 170Er (polyclonal, A045229-2, Dako), CD4 156Gd (clone EPR6855 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-SMA (M085129-2, Agilent). Anti-Perlecan antibody was a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... or anti-S100A1antibody (Dako, Z031129-2). Immunostained slides were counterstained with hematoxylin (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... Ki67 (Dako #M724001-2, 1:200). Full immunohistology protocol details available at http://help.brain-map.org/download/attachments/8323525/CellTypes_Morph_Overview.pdf?version=4&modificationDate=1528310097913&api=v2
-
bioRxiv - Cancer Biology 2021Quote: ... Low pH (Agilent Dako, S236984-2) in a PT Link instrument (Agilent Dako ...
-
bioRxiv - Cancer Biology 2021Quote: ... Low pH (Agilent Dako, S236984-2) in a PT Link instrument (Agilent Dako ...