Labshake search
Citations for Agilent :
101 - 150 of 1825 citations for N Furan 2 ylmethyl 3 bromo 4 fluoro benzamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... in 3 cycles for 3 hours using the Seahorse XFe24 analyzer system (Agilent Technologies). Inhibitors and substrates were used at the following concentrations ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm column (Agilent), column temperature 50 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were coverslipped using Di-N-Butyle Phthalate in xylene (DPX, Dako).
-
bioRxiv - Microbiology 2020Quote: ... 0.4μg of M and 0.8μg of N) using GeneJammer transfection reagent (Agilent). Medium was replaced 16h post-transfection ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by O/N incubation of primary antibody (GFAP (1:500, Dako) in 2% BSA ...
-
bioRxiv - Neuroscience 2021Quote: ... and the quality of the libraries were performed on a 2100 Bioanalyzer from Agilent using an Agilent High Sensitivity DNA kit (Agilent P/N 5067-4626). Sequencing libraries were loaded at 10 to 12pM on an Illumina HiSeq2500 with 2 × 50 paired-end kits using the following read length ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies (SARS-CoV2-N, Genetex GTX635679, 1:200; KRT7, Agilent Dako M701829-2 ...
-
bioRxiv - Genomics 2020Quote: ... Each pool (2nM per library; Agilent SureSelect XT HS, n=6; Agilent SureSelect XT RNA Direct ...
-
bioRxiv - Cell Biology 2022Quote: ... Data analysis: PNGase F released free N-glycan was identified by Agilent Masshunter Quantitative Analysis software by the presence of hexose and N-acetylhexosamine ...
-
bioRxiv - Physiology 2024Quote: ... fitted with a 150 µL glass insert (Agilent, P/N 5183-2088) and closed with a Teflon-lined septum cap (Agilent ...
-
bioRxiv - Pathology 2023Quote: ... Sections from the first level (main experiment) were stained for smooth muscle alpha-2 actin (ACTA2) and galectin 3 (LGALS3) using mouse monoclonal anti-ACTA2 (Dako, cat. no. M0851, 1:100) after blocking with Fab fragment (Jackson ImmunoResearch ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubated overnight at 4°C in primary antibody (2% NGS in TBST) with either rabbit anti-GFAP (1:2000, Agilent Cat# Z0334, RRID: AB_10013382), rabbit anti-synaptophysin (IgG ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2-4 images at the central callus and distal callus regions were taken using an automatic microscope (Agilent, BioTek Lionheart FX, Santa Clara, CA). Central callus regions were defined as proximal to the fracture site on either side of the bone ...
-
bioRxiv - Microbiology 2022Quote: ... LMP1 (CS1-4; Dako), CD81 (B399 ...
-
bioRxiv - Cancer Biology 2024Quote: ... version 4 (Agilent Technologies) was used to enrich sequencing libraries for exomes ...
-
bioRxiv - Cancer Biology 2024Quote: ... flowing 2 mM NH4CHO2 (Solvent A) and ACN (Solvent B) at 15 µL/min through a Zorbax SB-C18 column (Agilent, 0.5 x 150 mm, 3 µm). Quantitation was done monitoring MS/MS transitions m/z 242.1 [M + H]+ → m/z 126.1 [M – deoxyribose + H]+ for 5mC ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Neuroscience 2024Quote: ... 2) anti-fibrinogen (1/500) (Dako, A008002-2), 3 ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples were first treated by non-denaturing release overnight with N-glycanase (Prozyme) at 37°C and ...
-
bioRxiv - Microbiology 2024Quote: ... on an Agilent 6890 N gas chromatograph (Agilent Technologies, Inc., Santa Clara, CA) as described previously [28 ...
-
bioRxiv - Physiology 2024Quote: ... and closed with a Teflon-lined septum cap (Agilent, P/N 5191-8160). Whole body liquid extraction was performed in a solution consisting of 90 µL of hexane and 10 µL of 10 mg/mL hexacosane (Millipore Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-diaminobenzidine (DAB) solution (Dako, USA) until signal was detected ...
-
bioRxiv - Cancer Biology 2022Quote: ... and KI67 (clone TEC-3, Dako) were then incubated on the tissue slices and bound antibody was detected with biotinylated goat anti-rat IgG (Southern Biotechnology) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-diaminobenzidine tetrahydrochloride (DAB; Dako, K3467), as chromogen ...
-
bioRxiv - Biochemistry 2023Quote: ... or a BIOSEC 3 column (Agilent; flow rate ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ diaminobenzidine (DAB) (Dako, Carpinteria, CA) and counter-staining was done with hematoxylin ...
-
bioRxiv - Molecular Biology 2022Quote: 3*10^3 of HPLFs per well were seeded into Seahorse XFe96 well plate (Agilent Technologies, 200941) for overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... β1-4 galactosidase (Agilent Technologies), or double digestion with Sialidase A and β-galactosidase ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-LMP1 (CS1-4, Dako), anti-LMP2A (MCA2467 ...
-
bioRxiv - Immunology 2024Quote: ... β(1-4)-Galactosidase (Prozyme) (designated as “G”) ...
-
bioRxiv - Biochemistry 2021Quote: ... N-terminally His6-tagged KRAS was expressed in BL21-CodonPlus(DE3)-RIL cells (Stratagene) by isopropyl-β-D-1-thiogalactopyranoside induction at 18 °C ...
-
bioRxiv - Biophysics 2022Quote: TRPV4 N-terminal constructs were expressed in Escherichia coli BL21-Gold(DE3) (Agilent Technologies) grown in terrific broth (TB ...
-
bioRxiv - Biophysics 2024Quote: ... All mutations and N-terminal epitope tags were added using Pfu Turbo polymerase (Agilent). Primers are listed in Supplemental Table 1 ...
-
bioRxiv - Bioengineering 2024Quote: ... Purified mAbs were fluorescently labeled with GlykoPrep Rapid N-Glycan kit (ProZyme, Hayward, CA), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
Machine learning and data-driven inverse modeling of metabolomics unveil key process of active agingbioRxiv - Systems Biology 2024Quote: ... Gas separation was performed on the HP-5MS column (30 m 3 0.25 mm 3 0.25 mm, Agilent Technologies).
-
bioRxiv - Evolutionary Biology 2022Quote: ... Samples were inserted into a GC (Agilent 6890 N; Agilent Technologies, Santa Clara, CA, USA) by a MultiPurpose Sampler (MPS ...
-
bioRxiv - Biochemistry 2020Quote: The N-glycan analysis was performed on a 1260 Infinity liquid chromatography system (Agilent Technologies) coupled to a 6560 IM-QTOF mass spectrometer (Agilent Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... N-acetyl-PABA (NAPABA) was measured using high performance liquid chromatography (Agilent 1100 HPLC Series) as described elsewhere(Butcher et al ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Volatile compounds were analyzed using a 6890 N gas chromatograph (Agilent Technologies, Santa Clara, CA) with a DB5ms (60m ...
-
bioRxiv - Genomics 2024Quote: ... Fragment length was measured on Femto Pulse system (Agilent, CA, United States, Cat N° M5330AA) using the Genomic DNA 165 kb Ladder Fast Separation assay with a separation time of 70 min (Agilent ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4×44K (G4112F, Agilent Technologies, Germany).
-
bioRxiv - Cell Biology 2022Quote: ... Insulin (Agilent, IR-002, 1:4), and Glucagon (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... and 4% normal goat serum (Dako) in PBS for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... 3,3’-diaminobenzidine (DAB) substrate (Agilent Cat#GV82511-2 or GV92511-2), Dako REAL Peroxidase-blocking reagent (Agilent S202386-2) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2-deoxy-d-glucose (50 mM 2-DG, Agilent Technologies) as a glycolysis inhibitor ...
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...