Labshake search
Citations for Agilent :
151 - 200 of 1825 citations for N Furan 2 ylmethyl 3 bromo 4 fluoro benzamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Immunology 2020Quote: ... and isotype control: Glycans were prepared using the GlykoPrep® Rapid N-Glycan Preparation kit (PROzyme) and separated by Hydrophilic-Interaction Liquid Chromatography (HILIC ...
-
bioRxiv - Cancer Biology 2023Quote: ... N-Universal Negative Control Anti-Rabbit or Anti-Mouse (IS600 and IS750, respectively, Dako, Glostrup, Denmark) was used ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... CD68 (Dako (M087629-2)) 1/200 ...
-
bioRxiv - Cancer Biology 2021Quote: ... anti-BCL-2 (Dako) (M0887) ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mM glutamine (Agilent), 10 mM D-(+)-galactose) ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mM glutamine (Agilent) and 10 mM glucose (Agilent ...
-
bioRxiv - Cancer Biology 2024Quote: ... Hematoxylin (Agilent CS70030-2) then used to counterstain the nucleus ...
-
bioRxiv - Cancer Biology 2022Quote: ... Myogenin (Dako, IR06761-2), Desmin (Dako ...
-
bioRxiv - Immunology 2022Quote: ... 2 μM FCCP (Agilent) or 1 μM ionomycin (ChemCruz) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM glutamine (Agilent), 10 mM D-(+)-galactose) ...
-
bioRxiv - Microbiology 2022Quote: ... Ki67 (Dako M061601-2) at a 1:100 dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... Tau (A002401-2, Agilent) Phospho-Tau(Clone ...
-
bioRxiv - Developmental Biology 2024Quote: ... SMA (Agilent #M085129-2), Yap (CST #14074 and Santa Cruz #sc-101199) ...
-
bioRxiv - Immunology 2024Quote: ... oligomycin 2 μM (Agilent), 2-DG 50 mM (Sigma) ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 mL capacity (Agilent Cat. #: 5185-5991) and centrifuged at 17,172 × g for 45 min at 4 °C ...
-
The integrated stress response promotes macrophage inflammation and migration in autoimmune diabetesbioRxiv - Immunology 2024Quote: ... and anti-insulin (Dako; IR002; 1:4) antibodies ...
-
bioRxiv - Cancer Biology 2024Quote: ... (4) CD68 (Macrophages, 1:400, M0876; Dako)–Opal 620 ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were fixed with 3% formalin 3 days after the transfection and analyzed with the ACEA Quanteon (Agilent NovoExpresss Version 1.5.0), as described (22 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were fractionated on a reversed-phase Supelco Discovery BIO wide Pore C18-3 (4.6 × 150 mm, 3 µm particle size) column operated by a HPLC Agilent 1200 (Agilent Technologies, Waldbronn, Germany) chromatography system ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Biochemistry 2023Quote: ... Agilent Bio SEC-3 Column (Agilent Technologies, CA, USA) or HiLoad 16/60 Superdex 200 pg SEC column (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... using the Bio SEC-3 300A HPLC column (Agilent) and an isocratic elution with 100 mM ammonium acetate (pH 7.0 ...
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... (3) CD8 (Cytotoxic T Cells, 1:400, M7103; Dako)–Opal 570 ...
-
bioRxiv - Biochemistry 2020Quote: Skd3 variants were expressed as an N-terminally MBP-tagged protein in BL21 (DE3) RIL cells (Agilent). Cells were lysed via sonication in 40mM HEPES-KOH pH=7.4 ...
-
bioRxiv - Biochemistry 2022Quote: ... PARLSkd3 and variants were expressed with an N-terminal MBP-tag in BL21 (DE3) RIL cells (Agilent). Cells were lysed via sonication in lysis buffer (40 mM HEPES-KOH pH = 7.4 ...
-
bioRxiv - Microbiology 2020Quote: ... and n-caproate concentrations from the pH experiment were analyzed with an Agilent 7890B Gas Chromatograph (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... Japan) 41 with 2x hemagglutinin (HA) epitopes on the N-terminus into the pAAV-MCS vector (Agilent) and AAV9 was produced by Vigene or the Howard Hughes Medical Institute Viral Vector Core ...
-
bioRxiv - Neuroscience 2024Quote: ... the filter contents were injected into a gas chromatography (GC, Agilent 6890 N, Santa Clara, CA, USA) capillary column (DB-MS1 ...
-
bioRxiv - Genetics 2024Quote: ... 25 µL of each sample was then transferred to the polypropylene inserts (Agilent P/N 5182-0549) in amber vials immediately before the LC-MS/QTOF run ...
-
bioRxiv - Cell Biology 2024Quote: Respirometry of intact cells (n = 5–8 per cell line) was measured with a Seahorse Analyzer (Agilent) following the manufacturer’s guidelines ...
-
bioRxiv - Genomics 2022Quote: ... we established an automated 3’UTR-seq (QuantSeq 3’mRNA-seq; Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Biophysics 2024Quote: ... Fluorescence measurements were carried out using 3×3 mm quartz cuvettes (Hellma Analytics, LineaLab, Badalona, Spain) in a Cary Eclipse spectrofluorimeter (Agilent Technologies, Madrid, Spain). Blanks in the absence of protein were routinely measured and subtracted ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies were rabbit (P044801-2) or mouse (P044701-2) HRP-conjugated (Dako, Agilent), used at 1:10000 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies were rabbit (P044801-2) or mouse (P044701-2) HRP-conjugated (Dako, Agilent), used at 1:10000 dilution ...
-
bioRxiv - Microbiology 2022Quote: ... αIgG (Agilent Cat#A042402-2). Cells were cultured in RPMI-1640 (Invitrogen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Krt8/18 (DAKO M365201-2), GATA6 (R&D AF1700 ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Agilent, Cat# Z033429-2) Stained sections with only secondary antibodies were used as controls ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Agilent/Dako, Z033429-2), Lectin (Vector Labs ...