Labshake search
Citations for Agilent :
151 - 200 of 648 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Amplification of the HMPV N gene was performed by quantitative PCR using SYBR Green qPCR Master Mix (Agilent) and a set of primers listed in Table 1 ...
-
bioRxiv - Biochemistry 2021Quote: The second set of experiments was performed on Seahorse XF Cell Culture Microplates (Agilent, cat. n. 103022-100) with eight wells ...
-
bioRxiv - Microbiology 2024Quote: ... CH4 samples were analyzed immediately by flame ionization detection gas chromatography (Agilent 6890 N with Porapak Q column). The wetlands that were sampled in both experiments have no known prior history of agricultural use but are affected by runoff from surrounding agricultural and urban areas ...
-
bioRxiv - Neuroscience 2023Quote: ... XF L-Glutamine and cells were prepared for the Mito Stress Assay (Agilent) as per manufacture’s recommendations ...
-
bioRxiv - Cancer Biology 2024Quote: ... or 2 mM L-glutamine for the Glycolysis Stress Test (Agilent #103020-100). After an hour incubation at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cytokeratin (AE1/3) and vimentin (V9) were purchased from Dako Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2024Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cell Biology 2020Quote: ... and a mix of rotenone/antimycin A (stock solution 50 μM) (cat n. 103015-100, Agilent, Santa Clara, USA). Crystal violet was purchased from Sigma-Aldrich (cat n ...
-
bioRxiv - Bioengineering 2020Quote: ... The PHA monomers’ methylesters were assayed by GC using a Hewlett-Packard 6890 N chromatograph equipped with a HP-Innowax capillary column (30 m × 0.25 mm, 0.50-μm film thickness; Agilent Technologies) and a flame ionization detector (FID) ...
-
bioRxiv - Biochemistry 2020Quote: Nhp6 was expressed as a N-terminal 6x His-tag fusion protein in E.coli BL21-CodonPlus (DE3)-RIL cells (Agilent). A colony of cells freshly transformed with plasmid p1035 was grown in 3 L of LB supplemented with 50 μg/mL ampicillin and 34 μg/mL chloramphenicol at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... N≥50 worms (10 worms/ well) were transferred to the Seahorse XF96 Cell Culture Microplate (Agilent Technologies, 101085-004) in a total volume of 180 uL ...
-
bioRxiv - Immunology 2022Quote: ... The final set of nucleotide sequences was collapsed at 100% nucleotide sequence identity (n = 238,068) and then ordered from Agilent Technologies.
-
bioRxiv - Neuroscience 2023Quote: ... These pUAST-(G4C2)n vectors were amplified with a recombinase-mutated SURE®2 Escherichia coli strain (Agilent Technologies) at 28 °C for 72 hours to prevent repeat length contraction ...
-
bioRxiv - Bioengineering 2023Quote: ... After calibrating and verifying the performance of the column using the LC Bio-standard (Agilent, P/N : 5190-9417), the recombinant antibody samples were diluted to 2mg/ml in 1XPBS and loaded onto a pre-conditioned column at a flow rate of 0.35ml/min ...
-
bioRxiv - Immunology 2023Quote: ZIKV NS2B-NS3pro recombinant constructs with N-terminal His tag were used to transform competent E.coli BL21 (DE3) Codon Plus cells (Stratagene). Transformed cells were grown at 30°C in LB broth containing carbenicillin (0.1 mg/ml) ...
-
bioRxiv - Biochemistry 2020Quote: ... Daily MS calibration was performed with ESI-L Low Concentration Tuning Mix (Agilent Technologies). The internal calibrant was Hexakis(1H,1H,3H-tetrafluoropropoxy)phosphazene (Synquest Laboratories) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Immunohistochemical staining was performed using antibodies against MYC (clone L-26; DakoCytomation, Glostrup, Denmark) and BCL2 (clone 124 ...
-
bioRxiv - Microbiology 2024Quote: ... The mass spectrometer was calibrated in negative mode using ESI-L solution from Agilent technologies every 6 h to maintain the best possible mass accuracy ...
-
bioRxiv - Microbiology 2023Quote: ... The mass spectrometer was calibrated in negative mode using ESI-L solution from Agilent technologies every 6 hours to maintain the best possible mass accuracy ...
-
bioRxiv - Bioengineering 2024Quote: ... L-006235 was quantified by liquid chromatography tandem mass spectrometry (LC-MS/MS; Agilent 6530 quadrupole time-of-flight mass spectrometer with 1290 infinity binary ultra-performance liquid chromatography system ...
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Immunology 2022Quote: ... Samples were analyzed with a 3-laser flow cytometer (Agilent Novocyte) and data were processed with FlowJo (v10.1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luminescence was measured using a Cytation 3 Image Reader (Agilent). The luminescence of vehicle-treated controls was set to 100% ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luciferase activities were measured with Cytation 3 Image Reader (Agilent). Firefly luciferase activities were normalized to those of the Renilla luciferase.
-
bioRxiv - Cancer Biology 2024Quote: ... Absorbase (450nm) was red with BioTek Cytation 3 (Agilent, California, US).
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was quantified using the Gen5 Take 3 Module (Agilent BioTek) and assessed for quality with 260/230 absorbance ratio ...
-
bioRxiv - Biophysics 2021Quote: ... The plasmid encoding the protein fused with a His-tag at the N-terminus was transformed in BL21 DE3 pLysS strains (Agilent). Recombinant αE-catenin was expressed via isopropyl 1-thio-β-d-galactopyranoside (IPTG,Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... analysis of intact N-glycans was performed using 2-aminobenzamide (2-AB) labeling and separation on a Zorbax NH2 column (Agilent), essentially as described elsewhere [11 ...
-
bioRxiv - Evolutionary Biology 2020Quote: A mutant version of hA5 with a single N-terminal Cys residues were generated via sitedirected mutagenesis using the QuikChange lightning system (Agilent). The Cys was introduced in the Ser-Asn tag leftover from TEV protease cleavage as Ser-Asn-Cys ...
-
bioRxiv - Biochemistry 2021Quote: Rat Kir6.1 and N-terminal FLAG-tagged (DYKDDDDK) SUR2B were first cloned into pShuttle vectors and then the AdEasy vector (Stratagene), and packaged into recombinant adenoviruses in HEK293 cells according to manufacturer’s instructions63,64 ...
-
bioRxiv - Biochemistry 2021Quote: Tpm isoforms Tpm1.6 and Tpm3.1 (with and without Met-Ala-Ser at the N-terminus) were expressed in ArcticExpress(DE3) RIL cells (Agilent Technologies), grown in Terrific Broth (TB ...
-
bioRxiv - Biochemistry 2020Quote: ... Salmonella typhimurium MsbA (T561C in a C88A/C315A cysteine-less background) with an N-terminal poly-histidine-tag was expressed in BL21-CodonPlus (DE3)-RIPL (Agilent). Expression was induced with 1 mM IPTG for 4 hours at 30°C and membrane proteins were solubilized with 1% DDM and 0.04% sodium cholate in a buffer containing 100 mM NaCl ...
-
bioRxiv - Microbiology 2020Quote: ... 500 μl of culture headspace was sampled via gas-tight syringe and subject to gas chromatography through a HayeSep N column (Agilent) at 90°C in N2 carrier gas ...
-
bioRxiv - Biophysics 2021Quote: hnRNPA1* (where * denotes that the hexa-peptide 259-264 is deleted) protein and deletion constructs were expressed as N-terminally tagged hSUMO fusion proteins in BL21 (DE3) RIPL cells (Agilent) in LB media ...
-
bioRxiv - Biochemistry 2022Quote: ... or a FLAG tag (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) was added on the N-terminus of MBP WT or R919* TRPA1 using Quikchange Lightning site-directed mutagenesis (Agilent).
-
bioRxiv - Biochemistry 2022Quote: ... cholerae TrcP was sub-cloned into a custom pET vector and expressed as a 6× His-tagged N-terminal human SUMO2 fusion in E coli BL21 RIL bacteria (Agilent). A 50 ml starter culture grown overnight at 37°C in MDG medium (1.5% Bacto agar ...
-
bioRxiv - Neuroscience 2021Quote: ... TDP-43N-Del was generated by deletion of the first 81 amino acids from the N-terminus of TDP-43WT using the QuickChange Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Microbiology 2019Quote: ... Dried FAMES were redissolved in n-hexane and then quantified by gas chromatography (N6890, Agilent Technologies, Santa Clara, CA, USA) and identified with a MIDI Sherlock microbial identification system version 4.5 (MIDI Inc. ...
-
bioRxiv - Molecular Biology 2020Quote: ... NOCT N-terminal point mutants were generated from pCR4 TOPO NOCT (Open Biosystems) and Quikchange site directed mutagenesis PCR (Agilent) to generate NOCT(1-431 ...
-
bioRxiv - Biochemistry 2019Quote: ... vector encoding the pG gene as reported previously26 was site-specifically mutated by the insertion of an N-terminal serine using the QuikChange Lightning Multi Site-Directed Mutagenesis kit (Agilent), according to the manufacturer’s instructions using following forward and reverse primers (ser codon underlined) ...
-
bioRxiv - Microbiology 2019Quote: ... a BglII restriction site within the linker-sequence separating the N-terminal mCherry-tag from hGBP1 was eliminated in pmCherry-hGBP1 by Quickchange Site Directed Mutagenesis (Agilent) using the oligomer pair pmCherry-hGBP1DBglII-F and -R (Table S9) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6XHis tag was added to the N-terminus of Upf1 in pGEM-3Zf (+) using QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent) with oligonucleotides 5-N-His-UPF1 and 5-N-HIS-UPF1-r to yield pGEM3Zf(+)-6XHis-UPF1 ...