Labshake search
Citations for Agilent :
101 - 150 of 648 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... Fragment length was measured on Femto Pulse system (Agilent, CA, United States, Cat N° M5330AA) using the Genomic DNA 165 kb Ladder Fast Separation assay with a separation time of 70 min (Agilent ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-human prealbumin/TTR (1:1000, 2.0 g L−1, Dako), anti-DNAJB11/ERdj3 (1:1000 ...
-
bioRxiv - Microbiology 2022Quote: ... The instrument was calibrated using tuning mix (ESI-L, Agilent Technologies). The following instrumental settings were used ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human prealbumin/TTR (1:1000, 2.0 g L−1, Dako), anti-DNAJB11/ERdj3 (1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... High-quality RNA (RINl’.≥l’.9.0, measured in Agilent 4200 Tapestation) was sent to NovogeneAIT Genomics (Singapore ...
-
bioRxiv - Immunology 2024Quote: ... with 500 µg/l DAPI (Agilent, GM30411-2, 30 µl/sample)
-
bioRxiv - Immunology 2019Quote: ... and 20μg/mL anti-Ki67 (TEC-3, Dako) antibodies diluted in TBS with 2% donkey serum for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Microbiology 2019Quote: ... Hybridized arrays were scanned at 5 μm resolution on a Microarray Scanner (Agilent p/n G2565BA). Data extraction from images was done by using Agilent Feature Extraction (FE ...
-
bioRxiv - Immunology 2020Quote: ... and isotype control: Glycans were prepared using the GlykoPrep® Rapid N-Glycan Preparation kit (PROzyme) and separated by Hydrophilic-Interaction Liquid Chromatography (HILIC ...
-
bioRxiv - Cancer Biology 2023Quote: ... N-Universal Negative Control Anti-Rabbit or Anti-Mouse (IS600 and IS750, respectively, Dako, Glostrup, Denmark) was used ...
-
bioRxiv - Biochemistry 2019Quote: ... with a Supelco Discovery BIO wide Pore C18-3 column (4.6 x 150 mm, 3 µm particle size) using an Agilent 1260 High pressure Gradient System (Agilent, Waldbronn, Germany). The column was operated with a flow rate of 1 mL/min and performed ultrapure water with 0.1% (v/v ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... + rabbit anti-GFAP (1:500 dilutio L gilent Dako cat. no. Z0334), or mouse anti-GFAP (1:500 dilution ...
-
bioRxiv - Microbiology 2019Quote: ... An external calibration with ESI-L Low Concentration Tuning Mix (Agilent technologies) was performed prior to data collection and internal calibrant Hexakis(1H,1H,3H-tertrafluoropropoxy)phosphazene was used throughout the runs ...
-
bioRxiv - Biochemistry 2023Quote: ... The mass spectrometer was calibrated with tuning mix (ESI-L, Agilent Technologies). The following instrumental settings were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... 70 kDa subunit (NF-L, 1:500, Agilent, Santa Clara, CA, #M0762). Immunostained sections were counterstained with hemalum.
-
bioRxiv - Physiology 2023Quote: ... both solvents containing 5 µmol/L Infinity Lab deactivator additive (Agilent Technologies). The elution gradient used was as follows ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 2 mM Seahorse XF L-glutamine solution (103579-100, Agilent) and cells were kept in a CO2 free incubator for 1 h prior to starting the Glycolysis Stress Test ...
-
bioRxiv - Plant Biology 2024Quote: ... An external calibration with ESI-L Low Concentration Tuning Mix (Agilent Technologies) was performed prior to data collection ...
-
bioRxiv - Biochemistry 2020Quote: Skd3 variants were expressed as an N-terminally MBP-tagged protein in BL21 (DE3) RIL cells (Agilent). Cells were lysed via sonication in 40mM HEPES-KOH pH=7.4 ...
-
bioRxiv - Biochemistry 2022Quote: ... PARLSkd3 and variants were expressed with an N-terminal MBP-tag in BL21 (DE3) RIL cells (Agilent). Cells were lysed via sonication in lysis buffer (40 mM HEPES-KOH pH = 7.4 ...
-
bioRxiv - Microbiology 2020Quote: ... and n-caproate concentrations from the pH experiment were analyzed with an Agilent 7890B Gas Chromatograph (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... Japan) 41 with 2x hemagglutinin (HA) epitopes on the N-terminus into the pAAV-MCS vector (Agilent) and AAV9 was produced by Vigene or the Howard Hughes Medical Institute Viral Vector Core ...
-
bioRxiv - Cell Biology 2024Quote: ... 15000 cells were seeded in biological replicates (n=4) into 96 well seahorse cell culture microplates (Agilent) pre-treated with fibronectin (5 μg/mL) ...
-
bioRxiv - Neuroscience 2024Quote: ... the filter contents were injected into a gas chromatography (GC, Agilent 6890 N, Santa Clara, CA, USA) capillary column (DB-MS1 ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were fixed with 3% formalin 3 days after the transfection and analyzed with the ACEA Quanteon (Agilent NovoExpresss Version 1.5.0), as described (22 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were fractionated on a reversed-phase Supelco Discovery BIO wide Pore C18-3 (4.6 × 150 mm, 3 µm particle size) column operated by a HPLC Agilent 1200 (Agilent Technologies, Waldbronn, Germany) chromatography system ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3+ according to the HercepTest™ Interpretation Manual (DakoCytomation).
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Biochemistry 2023Quote: ... Agilent Bio SEC-3 Column (Agilent Technologies, CA, USA) or HiLoad 16/60 Superdex 200 pg SEC column (GE Healthcare ...
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Microbiology 2023Quote: ... using the Bio SEC-3 300A HPLC column (Agilent) and an isocratic elution with 100 mM ammonium acetate (pH 7.0 ...
-
bioRxiv - Cancer Biology 2024Quote: ... (3) CD8 (Cytotoxic T Cells, 1:400, M7103; Dako)–Opal 570 ...
-
bioRxiv - Genomics 2022Quote: ... we established an automated 3’UTR-seq (QuantSeq 3’mRNA-seq; Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Molecular Biology 2021Quote: PFDN5 ORF (splice variant alpha) was cloned EcoRI/SalI into pCMV-Tag 2A (N- terminal Flag tag, Agilent) or XhoI/EcoRI into pEGFP-C1 (N-terminal GFP tag ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by horseradish peroxidase (HRP)-conjugated anti-mouse antibodies (Cat. N. P044701-2, Agilent Technologies LTD, Cheadle, UK) (2.4μg/mL ...