Labshake search
Citations for Agilent :
1 - 50 of 648 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2019Quote: ... The microtissues were then washed in PBS (3 × 1 hour) before mounting on glass slides using fluoro-safe mounting media (Dako, S3023). Mounted samples were allowed to cure for 1 day and then imaged using a confocal microscope (Zeiss LSM700 Confocal Microscope).
-
bioRxiv - Biochemistry 2024Quote: ... which was restored to WT tyrosine using QuikChange (Agilent) mutagenesis.
-
bioRxiv - Microbiology 2023Quote: ... HT29 SGG UCN34 (n=3) were checked on RNA 6000 Nano chips (Bioanalyzer, Agilent) for quality and integrity ...
-
bioRxiv - Plant Biology 2024Quote: ... dissolved in 15 µl pyridine and derivatized with 30 µl N-methyl-N-(trimethylsilyl)trifluoracetamid (MSTFA) before being analyzed by GC-MS (Agilent 7890B GC-Agilent 5977N-MSD) as previously described (Berghoff et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... Tyrosine phosphorylated hnRNPA2 was grown in TKB1 competent cells (Agilent, 200134). 1 L cultures were grown at 18°C overnight to an OD600 of about 1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Microbiology 2020Quote: Two different glycosidases were used for specific removal of N-glycans: peptide N-glycosidase F (PNGase F) and endo N-glycosidase H (Endo H) (Prozyme, Hayward, CA). PNGase F removes all N-glycans from gp120/41 glycoprotein whereas Endo H removes high-mannose and hybrid glycans ...
-
bioRxiv - Immunology 2020Quote: ... 1 μM fluoro-carbonyl cyanide phenylhydrazone (FCCP) and 100 nM rotenone + 1 μM antimycin A (all from Agilent, Santa Clara, California) using a 96 well XF Extracellular Flux Analyzer (EFA ...
-
bioRxiv - Pathology 2020Quote: ... Cambridge, MA), CD68 (LV n=25, IVS n= 26, RV n=22) for macrophages (1:800, clone KP1, Dako/Agilent, Santa Clara, CA), and CD163 (LV n=26 ...
-
bioRxiv - Biophysics 2020Quote: ... Alanine substitution at the 511 tyrosine was made by site-directed mutagenesis using the QuikChange mutagenesis kit (Agilent Technologies).
-
bioRxiv - Pathology 2020Quote: ... Abcam, Cambridge, MA), CD68 (LV n=25, IVS n= 26, RV n=22) for macrophages (1:800, clone KP1, Dako/Agilent, Santa Clara, CA), and CD163 (LV n=26 ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Biophysics 2022Quote: ... a N-STORM 647 nm laser (Agilent), an iXon 897 Ultra EMCCD (Andor Technologies) ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 7.4 (Agilent, cat. n. 103575-100). The assay medium only was used as a blank in one well coated with dH2O and one well with Cell-Tak.
-
bioRxiv - Bioengineering 2023Quote: ... 4.6 × 300mm (Agilent, P/N: PL1580-5301) SEC column connected to Agilent 1260 Bioinert Infinity Quaternary Pump System (Pump serial# DEAGH00678) ...
-
bioRxiv - Bioengineering 2019Quote: N-linked glycans were released from purified antibody samples by overnight incubation with N-Glyccosidase F (Prozyme, GKE-5006B). The proteins were removed using LudgerClean glycan EB-10 cartridges (Ludger ...
-
bioRxiv - Biochemistry 2021Quote: ... The CD22 point mutations from tyrosine to phenylalanine were introduced by site-directed mutagenesis according to the QuikChange method (Agilent, Santa Clara, USA).
-
bioRxiv - Immunology 2022Quote: ... a variant mutated to change the tyrosines at positions 179 and 181 to phenylalanines was generated using a QuikChange II Site-Directed Mutagenesis Kit (#200523; Agilent, Santa Clara, CA) and the primer 5’ CATCCCCGCCTTCGCCTTCTATGTCTCACGTTGG 3′ ...
-
bioRxiv - Neuroscience 2020Quote: ... Cat N° R37605) for 20 min and coverslips were mounted with Fluorescence Mounting Medium (Dako, Glostrup, Denmark, Cat N° S3023), while wells in the device were sealed with one drop of mounting medium per well before acquiring images ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2022Quote: ... 5 μm column (Agilent p/n 993967-902). For the HPLC ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2019Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation ...
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Microbiology 2022Quote: ... an ESI-L Mix (Agilent) was injected.
-
bioRxiv - Biochemistry 2023Quote: ... 800 µL sample and MTBSTFA (100 µL, N-tert-butyldimethylsilyl)-N-methyltrifluoroacetamide) were transferred to amber capped glass vials (Agilent Technologies, USA), heated to 80 °C for 20 min ...
-
bioRxiv - Biochemistry 2022Quote: Offline N-glycan analysis was done using AdvanceBio Gly-X N-glycan prep with InstantPC (GX96-IPC, Agilent Technologies, Santa Clara, CA) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: Offline N-glycan analysis was done using AdvanceBio Gly-X N-glycan prep with InstantPC (GX96-IPC, Agilent Technologies, Santa Clara, CA) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... dissolved in 15 µl pyridine and derivatized with 30 µl N-methyl-N-(trimethylsilyl)trifluoracetamid (MSTFA) before being analyzed by GC-MS (Agilent 7890B GC-Agilent 5977N-MSD) as previously described (Berghoff et al. ...
-
bioRxiv - Systems Biology 2019Quote: ... N-glycans were released by PNGase F (Prozyme, USA) from post nuclear fraction of CHO cell lysate which had been subjected to reduction ...
-
bioRxiv - Microbiology 2022Quote: ... consisting of a model 6890 N gas chromatograph (Agilent).
-
bioRxiv - Cancer Biology 2023Quote: ... anti-IgL (Clone: N/A; 1:400; Agilent; #GA507), and anti-IgK (Clone ...
-
bioRxiv - Bioengineering 2023Quote: ... and n-caprylate by an Agilent 7890B GC (Agilent Technologies ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Chromagen was developed using the DAB (3, 3-diaminobenzidine) reagent (Dako). Sections were counter-stained using pre-filtered Mayer’s haematoxylin (Amber Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Antigen–antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with haematoxylin (Dako ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen-antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with hematoxylin (Dako ...
-
bioRxiv - Physiology 2022Quote: ... Antigen–antibody complexes were revealed with 3-3′- diaminobenzidine (K346811, Dako) or the DAB (Polymer ...
-
bioRxiv - Cell Biology 2024Quote: ... at 1:500 and 3-3’-diamino-benzidine-tetrahydrochloride (Dako, K3468). Stained sections were imaged using an NanoZoomer 2.0HT (Hamamatsu).
-
bioRxiv - Immunology 2022Quote: ... supplemented with 2mM L-glutamine (Agilent), 1mM sodium pyruvate (Agilent) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 mM L-glutamine (Agilent) and the cells were placed in a non-CO2 incubator set at 37°C for approximately 1 h before starting the assay ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1.25 mM L-glutamine (Agilent), with pH adjusted to 7.38-7.42 ...
-
bioRxiv - Microbiology 2022Quote: ... HRP-labelled goat anti-mouse immunoglobulin (cat. n° P0447, Dako). The following antibodies were used for flow cytometry ...
-
bioRxiv - Cancer Biology 2023Quote: ... and anti-IgK (Clone: N/A; 1:4000; Agilent; #A0191). Optimization of the antibodies and staining conditions was carried out on sections of human tonsil ...
-
bioRxiv - Genetics 2022Quote: ... and antimycin/rotenone (1 mmol/L and 1 mmol/L) (Cell Mito Stress Test Kit, Agilent, #103015100). Analysis was carried out by using the Seahorse analyzer software.
-
bioRxiv - Microbiology 2021Quote: ... Tissue sections were colored via DAB-staining (3, 3-diaminobenzidine; Dako, K3468).
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-Diaminobenzidine (DAB, Agilent) and then counterstained with haematoxylin (Abcam) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... or Streptococcus pneumoniae β-N-Acetylhexosaminidase (Prozyme, 4 mU per digest) overnight at 37°C in 20 mM sodium acetate (pH 5.0).
-
bioRxiv - Cancer Biology 2020Quote: ... Immunostaining was detected using 3,3’-diaminobenzidine (Agilent Dako, Cat # N-1939) peroxidase chromogen substrate ...
-
bioRxiv - Cancer Biology 2020Quote: ... Immunostaining was detected using 3,3’-diaminobenzidine (Agilent Dako, Cat # N-1939) peroxidase chromogen substrate ...
-
bioRxiv - Cell Biology 2021Quote: ... The N-terminal region was removed by a Quikchange reaction (Agilent), and the resulting shortened fragment was inserted into the pDEST-HisMBP destination vector via a Gateway reaction.