Labshake search
Citations for Agilent :
1451 - 1500 of 1696 citations for 5 Pyrimidinecarboxaldehyde 2 amino oxime 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 100 µl of purified proteins at ∼2 mg/ml concentration were injected onto a Superdex 200 Increase 10/300 column (Cytiva) on an HPLC (Agilent) connected to miniDAWN TREOS and Optilab T-rEX detectors (Wyatt Technology) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... An aliquot of 200 µL from each sample was separated and diluted to 2 mL of 2% v/v HNO3 and analysed for Sr content via inductively coupled plasma mass spectrometry (ICP-MS; Agilent 8800 ICP-QQQ ...
-
bioRxiv - Genomics 2023Quote: ... OD600 measurements were performed at 30°C every 15 min until a plateau was reached in a BioTek Epoch 2 Microplate Spectrophotometer (Agilent).
-
bioRxiv - Plant Biology 2024Quote: ... Peptides were desalted as previously described (60) using an OT-2 liquid handling robot (Opentrons Labworks Inc.) mounted with Omix C18 pipette tips (A5700310K; Agilent). Desalted peptides were dried and stored at - 80°C prior to re-suspension in 3.0% (v/v ...
-
bioRxiv - Neuroscience 2024Quote: ... The cells were washed once with DMEM Assay Medium (XF DMEM [Agilent] supplemented with XF glucose [10 mM, Agilent], XF glutamine [2 mM, Agilent] and XF pyruvate [1 mM, Agilent]), then left in DMEM Assay Medium and placed in a non-CO2 incubator for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... Culture plates were incubated at 37°C for 22 hrs and kept anaerobic during the OD600 measurement in a Synergy 2 Plate Reader (Biotek Agilent Technologies Deutschland GmbH ...
-
bioRxiv - Cancer Biology 2023Quote: ... The organic samples were resuspended in 200 µL of 2:1:1 isopropyl alcohol:acetonitrile:water and transferred to amber glass mass spectrometry vials (Agilent 5182-0716) containing a glass insert ...
-
bioRxiv - Cancer Biology 2023Quote: ... The organic samples were resuspended in 35x the packed cell volume using 2:1:1 isopropyl alcohol:acetonitrile:water and transferred to amber glass mass spectrometry vials (Agilent, 5182-0716) containing a glass insert ...
-
bioRxiv - Cancer Biology 2023Quote: ... was performed using the Exome Cancer Test v2.0 (EXaCT-2) assay that was developed with Agilent based on SureSelect Human All Exon V6 (Agilent Technologies) (manuscript in preparation) ...
-
bioRxiv - Cancer Biology 2024Quote: Paraffin-embedded human HCC samples were cut into 3.5-µm thick tissue sections and processed for immunohistochemistry with the EnVision FLEX kit material (K800021-2, Agilent Dako) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Oxygen consumption rate of U2OS WT and G3BP1/2 dKO cells was measured on an extracellular flux analyzer (Agilent Seahorse) using the XF Cell Mito Stress Test Kit following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Molecular Biology 2023Quote: ... On day 2 the XF Real-Time ATP Rate Assay Kit (Cat. No. 103592-100, Agilent Technologies, Cedar Creek, TX) was run following the manufacturer’s protocol using the Seahorse XF96 Analyzer as described above.
-
bioRxiv - Plant Biology 2023Quote: ... acetonitrile and 2 µl was injected for the analysis with LC/MS (6520 Accurate-Mass Q-TOF connected to Agilent 1100 Series HPLC ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.2% Triton X-100 and incubation with appropriate secondary antibody for 2 hr at room temperature in blocking buffer before washing and mounting in fluorescent mounting medium (DAKO). Images were acquired using a Leica SP8 confocal microscope ...
-
bioRxiv - Immunology 2024Quote: ... The membranes were washed and incubated at room temperature for 1 h with rabbit anti-mouse IgG (Agilent, P026002-2) or goat anti-rabbit IgG (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... and MØ cell culture media was replaced with FCS-and bicarbonate-free DMEM medium supplemented with 4.5 mg ml-1 D-glucose and 2 mM glutamine (Agilent, USA) for another 60 min incubation at 37°C without CO2 ...
-
bioRxiv - Genomics 2024Quote: ... We selected for guide integration with 2µg/ml puromycin and then induced prime editor expression with 1 µM doxycycline and determined editing rates by visualizing amplicons (Supplementary Table 2) on the bioanalyzer (Agilent).
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... Epitope retrieval was then performed at 95 °C for 10 min at pH 9 (Dako Target Retrieval Solution, S236784-2) in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype: rabbit immunoglobulin fraction, DAKO). Alexa labeled secondary antibodies (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Biophysics 2021Quote: ... Mutations of key contact points between docked ligands and the human 5-HT5AR binding pocket were made via site-directed mutagenesis as directed (Stratagene, La Jolla, CA). Quickchange II mutagenic primer sets were the following ...
-
bioRxiv - Microbiology 2021Quote: The determination conditions of bacillomycin D and fengycin were established by injecting 10 μL samples into an HPLC column (Eclipse XDB-C18, 5 μm; Agilent, Santa Clara, CA). The temperature was maintained at 30 °C during the experiment ...
-
bioRxiv - Cell Biology 2021Quote: ... was then mutated to either R to mimic deacetylated c-Myc (K323R) or Q to mimic acetylated c-Myc (K323Q) using QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies, 200522-5) against pPHAGE-EF1α-HA-Puro-c-Myc ...
-
bioRxiv - Genomics 2020Quote: ... and electroporated in 5 separate cuvettes containing 4 µL of the plasmid and 40 µL of ElectroTen-Blue electrocompetent cells (Agilent Santa Clara, CA). After a 1 hour outgrowth in LB at 37C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples analyzed by mass spectrometry were resolved using a Poroshell StableBond 300 C8 (2.1 x 75 mm, 5 μm, Agilent Technologies part #660750-906) using a 1290 Infinity II UHPLC (G7120AR ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Blots were washed clear of unbound antibody in TBS-T before addition of anti-rabbit-HRP secondary antibody (1:1000 in 5% milk/TBS-T; Agilent Technologies, CA, U.S.A.) for 1 hr at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... The pcDNA3.1 Flag-mRBPJ A284V CRr and the pcDNA3.1 Flag-mRBPJ F261A/A284V CRr were generated via site directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies 200521-5) accordingly to manufacturer’s instructions with the oligos listed in Table S6 and using the pcDNA3.1 Flag-mRBPJ WT CRr and the pcDNA3.1 Flag-mRBPJ A284V CRr as templates ...
-
bioRxiv - Microbiology 2020Quote: ... The derivatized samples were analyzed on an Agilent GC-MS (GC model 7890A, MS Model 5975C) equipped with a (5% phenyl)-methylpolysiloxane capillary column (Agilent model HP-5MS). The injection port temperature was held at 280 °C and the oven temperature program was held at 80 °C for 1 min ...
-
bioRxiv - Biochemistry 2021Quote: ... Analyses were performed on an Agilent Infinity 1260 HPLC system equipped with a 300 × 7.5 mm PLgel SE-HPLC column (particle size 5 μm, pore size 100 Å) (Agilent Technologies, Waldbronn, Germany). Dichloromethane was used as eluent at a flow rate of 1.00 ml/min ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli was carried out with a ZORBAX SB-Aq StableBond Analytical column (5 μm, 4.6 × 250 mm, Agilent Teologies, Santa Clara, CA, USA). A linear gradient of acetonitrile and water with 0.1% trifluoroacetic acid was used for development of the column at a flow rate of 0.8 mL/min ...
-
bioRxiv - Genetics 2021Quote: ... Samples were frozen at -80 C until volatiles were separated using a DB-5 column on a Agilent 6890N gas chromatograph attached to an Agilent 5975 mass spectrometer (Agilent, Palo Alto, CA). Volatile quantitation was preformed using ChemStation software (Agilent ...
-
bioRxiv - Biochemistry 2021Quote: ... (N-acetyl)paenilamicin-containing fractions were concentrated and purified subsequently by using a Grace HPLC column (GROM-Sil 120 ODS-5-ST, 10 µm, 250 × 20 mm) coupled to an Agilent 1100 HPLC system (Agilent Technologies, Waldbronn, Germany) with a MWD UV detector ...
-
bioRxiv - Immunology 2021Quote: Final V(D)J and 5’ GEX libraries were run on a Bioanalyzer 2100 with a High Sensitivity DNA kit (Agilent, Santa Clara, CA) to assess library size and concentration ...
-
bioRxiv - Bioengineering 2022Quote: ... and the plates were incubated at 37 °C and 5% CO2 in a BioSpa live cell analysis system (Agilent Technologies, Santa Clara, CA) for 45 hours.
-
bioRxiv - Immunology 2022Quote: ... Quality control of the libraries to ensure no adapter dimers were present was carried out by examining 1ul of a 1:5 dilution on a High Sensitivity DNA chip (Agilent Technologies: 5067-4626) on an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Plant Biology 2022Quote: ... We analyzed 50 µL of each sample using an Agilent 1100-series HPLC machine with a diode array detector and a Zorbax Eclipse XDB-C18 column (4.6 x 150 mm, pore size 5 µm; Agilent Technologies, Santa Clara, USA). Desulfinated glucosinolates were separated at 40°C in a mobile phase beginning with 1.5% acetonitrile (ACN ...
-
bioRxiv - Plant Biology 2022Quote: ... Samples of the final supernatant (5 μL) were automatically injected into a triple quadrupole (QqQ) LC-MS instrument (6430; Agilent Technologies, Waldbronn, Germany) equipped with an Eclipse Plus C18 column (2.1 × 50 mm ...
-
bioRxiv - Biochemistry 2023Quote: ... Assays were performed on an Agilent 1100 series HPLC with a reverse phase column (Agilent Zorbax 300SB-C18, 5 μM, 2.1 × 150 mm). Solvent A was water containing 0.1% TFA and solvent B was acetonitrile containing 0.1% TFA ...
-
bioRxiv - Microbiology 2023Quote: ... using two different carrier gases (argon and helium) and two stationary phases (CP- Molsieve 5 Å Plot and PoraPLOT U J&W GC columns, Agilent Technologies, Germany). Moreover ...
-
bioRxiv - Neuroscience 2024Quote: ... 10ug of total synaptosomal protein was plated in each well of a polyethyleneimine coated 96 well plate (n=5-6/animal) and analyzed using the MitoStress kit from Agilent (Santa Clara, CA). The MitoStress kit measures oxygen consumption rate (OCR ...
-
bioRxiv - Microbiology 2023Quote: ... ODs were obtained by measuring absorbance at 600nM in a 96-well plate using Cytation Station 5 (BioTek Agilent Technologies, Santa Clara, CA). The liquid cultures were centrifuged at 3500 rpm for 5 minutes (Sorvall Legend X1R M20 rotor ...
-
bioRxiv - Microbiology 2023Quote: ... ODs were obtained by measuring absorbance at 600nM in a 96-well plate using Cytation Station 5 (BioTek Agilent Technologies, Santa Clara, CA). 108 colony-forming units (CFUs ...
-
bioRxiv - Bioengineering 2024Quote: ... and the plates were incubated at 37°C and 5% CO2 in a BioSpa live cell analysis system (Agilent Technologies, Santa Clara, CA) for 45 hours.
-
bioRxiv - Cell Biology 2023Quote: ... After washing for three times (5 mins) with H2O followed by three washing steps with Dako wash buffer (Agilent Technologies, Santa Clara, USA), antigen retrieval was done in a steamer using pH9 antigen retrieval from Dako ...
-
bioRxiv - Bioengineering 2024Quote: ... and the plate was incubated at 37 °C and 5% CO2 in a BioSpa live cell analysis system (Agilent Technologies, Santa Clara, CA) for 48 hours (Fig ...
-
bioRxiv - Immunology 2024Quote: ... using an Agilent 7890B gas chromatograph equipped with a 30 m DB-35ms and 5 m Duraguard capillary column (Agilent, Santa Clara, California) for separation of derivatized metabolites ...
-
bioRxiv - Biophysics 2021Quote: ... 7.8 mm ID x 300 mm column equilibrated in GF150 buffer (25 mM HEPES-KOH, 150 mM KCl, 2 mM MgCl2) plumbed into an HPLC (Agilent 1100). Molecular masses were analyzed by an inline SEC-MALs system (Wyatt Technology ...