Labshake search
Citations for Agilent :
1151 - 1200 of 1696 citations for 5 Pyrimidinecarboxaldehyde 2 amino oxime 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Bioengineering 2024Quote: ... Two-channel 85 µm z-stack images were taken using a Cytation 5 V3.14 cell imaging multi-mode reader (Agilent Technologies). A total of 21 z-stacks per well and per experiment were recorded and used for post-processing to calculate the cell phenotypic response in each hydrogel model.
-
bioRxiv - Systems Biology 2024Quote: ... elav (Developmental Studies Hybridoma Bank, 9F8A9 at 1:20 and 7E8A10 at 1:5) and PCNA (DAKO, MO879, 1:500). For immunofluorescence studies ...
-
bioRxiv - Immunology 2024Quote: ... Greyhound Chemicals), 10% LC-MS grade water (Ultra CHROMASOLV, Honeywell Riedel-de Haën) with 5 uM InfinityLab deactivator additive (Agilent Technologies).
-
bioRxiv - Developmental Biology 2024Quote: Amplicons per sample were pooled to a maximum concentration of 5 ng/µl and assessed for DNA quality using a fragment analyzer (Agilent) and the Qubit™ dsDNA HS Assay kit (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... The sample (5 µl injection volume) was separated on a ZORBAX Eclipse Plus C18 (2.1×50 mm, 1.8 µm, Agilent Technologies, Inc.). Data analysis was performed with Agilent Profinder (v10.0 SP1 ...
-
bioRxiv - Physiology 2023Quote: HPLC separation was performed on an Agilent 1100 HPLC system using a 5 µm C18 column (4.6 mm × 150 mm, Agilent-XDB), maintained at 30°C ...
-
bioRxiv - Microbiology 2024Quote: ... and 280 nm with a Eclipse Plus Phenyl-Hexyl column (250 mm length, 4.6 mm diameter, 5 μm particle size, Agilent Technologies). The flow rate was set to 0.5 mL/min for a 70/30 combination of the mobile phase in water and acetonitrile (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: ... The volatile components were separated by a DB-5 capillary column (30 m × 0.25 mm × 0.25 μm, Agilent, CA, USA) using high-purity helium as carrier gas with a 1.5 mL/min flow rate ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Cell Biology 2024Quote: The fluorescence from mNG21-10/mNG211 complementation was visualized the day after transfection with the pH2B-mNG211 plasmid using a Cytation 5 microscope (Agilent) equipped with a 20x/0.45 NA phase contrast objective ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies (Supplementary Table 2) were diluted according to manufacturer’s guidelines in DAKO Antibody Diluent (cat. S202230, Agilent). Cells were incubated with the primary antibody mixes overnight at 4°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Both the trap (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and the analytical (Agilent Poroshell EC-C18 ...
-
bioRxiv - Microbiology 2021Quote: ... we generated a pT7-D6/2-NSP1-null via the QuikChange II site-directed mutagenesis kit (Agilent Technology) based on pT7-D6/2-NSP1 (22) ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by horseradish peroxidase (HRP)-conjugated anti-mouse antibodies (Cat. N. P044701-2, Agilent Technologies LTD, Cheadle, UK) (2.4μg/mL ...
-
bioRxiv - Neuroscience 2020Quote: ... The tissues were deparaffinized to distilled water and the antigen retrieval performed with Proteinase K (Dako #S302030-2) treatment for 2 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... qRT-PCR reactions contained 10 μL of 2×Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent), 2 μL of each 2 μM primers (Table S5) ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 µl aliquot of the sample was injected into LC-QTOF-MS system (Agilent, 6545 LC/QTOF-MS) coupled with a C18 column (ZORBAX RRHD Plus C18 ...
-
bioRxiv - Plant Biology 2021Quote: ... All mutations listed in Supplemental Table 2 were introduced using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent) with appropriate mutagenic primers ...
-
bioRxiv - Plant Biology 2021Quote: ... Purified peptide suspensions (2 μL each) were injected into a HPLC-chip (Polaris-HR-Chip-3C18, Agilent Technologies) through a capillary pump with a flow at 1.5 μL/min ...
-
bioRxiv - Microbiology 2021Quote: ... and the quality was checked on 2% agarose gel and verified using the Agilent Bioanalyser 2100 (Agilent technologies). RNAs selected for further analysis had a minimum RNA Integrity Number (RIN ...
-
bioRxiv - Cancer Biology 2022Quote: ... the slices were incubated with primary antibodies: rabbit polyclonal anti-PSMA/GCPII (1:150) (M362029-2; DAKO, US), anti-CD68 (1:250 ...
-
bioRxiv - Microbiology 2022Quote: ... Sections for SARS-CoV-2 IHC were blocked with 10% goat serum (X0907, DAKO, Agilent Technologies Netherlands B.V) for 30 min at RT ...
-
bioRxiv - Microbiology 2022Quote: ... Sections for SARS-CoV-2 IHC were blocked with 10% goat serum (X0907, DAKO, Agilent Technologies Netherlands B.V) for 30 min at RT ...
-
bioRxiv - Physiology 2020Quote: ... DAPI (4′,6-diamidino-2-phenylindole; 1:1000) was used as nuclei staining and fluorescent mounting medium (DAKO) to cover the slides before imaging acquisition ...
-
bioRxiv - Microbiology 2020Quote: ... coli Lgt fused to a C-terminal Flag-tag was transformed into Rosetta 2(DE3) Gold cells (Agilent). Starter cultures were grown in Terrific Broth (TB ...
-
bioRxiv - Neuroscience 2021Quote: ... GFP-ALG-2 was obtained by performing a reverse mutagenesis (Quick change II site directed mutagenesis kit, Stratagene) on a GFP-hALG-2 Y180A (a generous gift from Masatoshi Maki ...
-
bioRxiv - Genetics 2019Quote: ... We collected the supernatant and read 2 μl from each sample in the TapeStation (Agilent high sensitives D1000) to verify fragment size ...
-
bioRxiv - Cancer Biology 2021Quote: ... The slides were incubated with appropriate primary antibodies diluted in EnVision FLEX Antibody Diluent (Agilent Dako, K800621-2) overnight at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... The slides were incubated with appropriate primary antibodies diluted in EnVision FLEX Antibody Diluent (Agilent Dako, K800621-2) overnight at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... and AlixΔPGY (AlixΔALG-2) cDNAs in pCI were generated by mutagenesis (Quick change II site directed mutagenesis kit, Stratagene) and Alix R757E (AlixΔendo ...
-
bioRxiv - Genomics 2020Quote: The Aβ coding sequence and two flanking regions of 52bp and 72bp respectively upstream and downstream of Aβ were amplified (primers MS_01 and MS_02, Supplementary file 2) by error-prone PCR (Mutazyme II DNA polymerase, Agilent). 30 cycles of amplification and 0.01ng of initial template were used to obtain a mutagenesis rate of 16 mutations/kb ...
-
bioRxiv - Genomics 2020Quote: ... 1 - 2 ng / µl was examined using a 2100 Bioanalyzer and a corresponding High Sensitivity DNA Kit (Agilent) to determine the MW profile of the size-selected library ...
-
bioRxiv - Immunology 2021Quote: A pAAV-MCS plasmid containing inverted terminal repeats (ITRs) from AAV serotype 2 (Agilent Technologies, Santa Clara, CA) was utilized as backbone for AAV6 plasmid construction (naturally occurring AAV6 has an AAV2 ITR (24)) ...
-
bioRxiv - Cell Biology 2021Quote: ... T-cell lymphoma diagnoses were confirmed by immunohistochemical staining of sections with anti-CD3 antibody (Agilent, M725429-2) and DAB solution development.
-
bioRxiv - Microbiology 2022Quote: ... pneumoniae was done in 96 well microtitre plates using a BioteK Epoch-2 microtiter plate reader (Agilent Technologies). Each treatment was replicated in at least 3 wells ...
-
bioRxiv - Cancer Biology 2022Quote: 2×104 – 4×104 cells per well were plated onto a Seahorse XFe96 FluxPak plate (Agilent, 102416-100). On the day of the assay ...
-
bioRxiv - Developmental Biology 2022Quote: ... Repeated washes were performed before incubation with secondary antibody (FITC-labelled swine anti-rabbit F (ab’)2 (Dako) or Alexa Fluor 647-labelled goat anti-rabbit IgG (Molecular Probes ...
-
bioRxiv - Physiology 2022Quote: ... were placed in 50 µl XF medium (non-buffered DMEM containing 10 mM glucose and 2 mM GlutaMax, pH 7.3-7.4, Agilent), centrifuged in a carrier tray (300g for 3 min with no break) ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides were incubated for 20 minutes in a microwave oven in DAKO Target Retrieval pH6 (S203130-2, DAKO, Agilent Technologies ...
-
bioRxiv - Bioengineering 2022Quote: ... before incubating in primary antibody diluted in DAKO antibody diluent (Cat# S080983-2, Agilent, Santa Clara, CA, USA) for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... the buffer was exchanged into basic PBS (pH 8.0) with 0.1 % Tween-20 for a 2-hour conjugation of 12.0 μM streptavidin (Prozyme, SA10) and 100 μM fluorescent dye (Alexa Fluor 488 Cadaverine or Lissamine Rhodamine B ethylenediamine ...
-
bioRxiv - Cancer Biology 2023Quote: ... The slides were steamed for 35 minutes with a pH 6 Dako Target Retrieval (Agilent Technologies, S169984-2) and permeabilized with 0.1% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... transferred onto glass slides and mounted with a fluorescence anti-fading mounting medium (DAKO Fluoromount; #S302380-2, Agilent). In order to reduce age-related autofluorescence in human cortical slices ...
-
bioRxiv - Neuroscience 2023Quote: ... transferred onto glass slides and mounted with a fluorescence anti-fading mounting medium (DAKO Fluoromount; #S302380-2, Agilent). In order to reduce age-related autofluorescence in human cortical slices ...
-
bioRxiv - Immunology 2024Quote: ... sections were stained with monoclonal mouse anti-human CD68 clone PG-M1 - 1:100 (Dako Omnis: GA61361-2). Second antigen retrieval and blocking were performed as described above and subsequent staining was performed with either rabbit anti-Gas6 - 1:100 (PA5-79300 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Antigen retrieval was then performed at 97 °C for 10 minutes with Target Retrieval Solution (Agilent, S236784-2) on a PT Module (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: Growth curves for H53 wild type and ΔcirA strains were measured using BioTek Epoch 2 microplate reader with BioTek Gen6 v.1.03.01 (Agilent). Colonies of each strain were inoculated in 5 mL Hv-Cab liquid medium and grown shaking at 45°C until an OD600 0.15 was reached ...
-
bioRxiv - Biochemistry 2024Quote: ... Headspace GC measurements were carried out on an Agilent 8890 gas chromatograph system equipped with a flame ionization detector (FID) and a Hayesep Q packed column (1.8 m x 2 mm x 3.17 mm) (Agilent) operating with an Argon carrier gas (flow rate= 5 mL/min) ...