Labshake search
Citations for Agilent :
1201 - 1250 of 1696 citations for 5 Pyrimidinecarboxaldehyde 2 amino oxime 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... 2009) (1μg) were co-transfected into H9 hESC (70,000 cells cm-2) using GeneJammer transfection reagent (Agilent Technologies). To enrich for successfully transfected cells ...
-
bioRxiv - Bioengineering 2021Quote: ... 10-20 µl injection volume depending on protein concentration) were injected on a Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) at a flow rate of 100 µl/min using solvent A (0.1% formic acid and 0.05% trifluoroacetic acid in water ...
-
bioRxiv - Molecular Biology 2021Quote: Cross-linked peptides were enriched with Fe(III)-NTA 5 µL in an automated fashion using the AssayMAP Bravo Platform (Agilent Technologies). Fe(III)-NTA cartridges were primed with 250 µL of 0.1% TFA in ACN and equilibrated with 250 µL of loading buffer (80% ACN/0.1% TFA) ...
-
bioRxiv - Genomics 2020Quote: ... gDNA before SRE treatment was diluted 5-fold and the undiluted solution after SRE treatment was used according to the protocol using TapeStation 2200 (Agilent Technologie) and Genomic DNA ScreenTape (Agilent Technologie).
-
bioRxiv - Genetics 2019Quote: ... All qRT-PCR experiments were performed on diluted cDNA (1:5 in nuclease-free water) using the Brilliant II SYBR Green qPCR Master Mix (Agilent Technologies) and the 7900HT Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2019Quote: ... After one last wash with DPBS for 5 minutes at RT the coverslips were imbedded in fluorescent mounting medium (DAKO #S3023). Primary antibodies that were used ...
-
Quantitative proteomics reveals remodeling of protein repertoire across life phases of Daphnia pulexbioRxiv - Systems Biology 2019Quote: ... Pooled samples were desalted via C18 SPE on Sep-Pak cartridges as described above and subjected to basic pH reversed-phase liquid chromatography (bRPLC)[25] over a 4.6 mm x 250 mm ZORBAX Extend C18 column (5 μm, 80 Å, Agilent Technologies) with concatenated fraction combining as previously described ...
-
bioRxiv - Plant Biology 2020Quote: ... All samples were diluted to 3.5 % HNO3 prior to multi-elemental analysis using Inductively-Coupled Plasma Optical Emission Spectrometry (ICP-OES) (5100 ICP-OES, Agilent Technologies). The ICP-OES was equipped with a SeaSpray nebuliser and a double pass scott type spray chamber ...
-
bioRxiv - Genomics 2019Quote: ... Each pool of RNA was individually labelled with Cyanine-3 and Cyanine-5 (Cy3 and Cy5) using the Low input Quick Amp Labelling Kit (Agilent Technologies) followed by purification through Qiagen RNeasy Columns (Qiagen ...
-
bioRxiv - Systems Biology 2020Quote: ... 3 μl of each sample containing approximately 10 μg of total native peptides and 500 fmol of each stable isotope-labeled standard (SIS) peptide were loaded on an analytical column, Zorbax 300SB-C18 (5 μm, 150 × 0.3 mm) (Agilent Technologies, USA) and washed with 5% acetonitrile for 5 min at a flow rate of 20 μl/min ...
-
bioRxiv - Cancer Biology 2021Quote: ... The DNA was denatured at 95°C for 5 min in a PCR machine (PTC-200, MJ Research; PCR strip tubes (Agilent 410022)) and then incubated with the biotin capture RNA at 65°C ...
-
bioRxiv - Biochemistry 2020Quote: The peptide was purified by high-performance liquid chromatography (HPLC) on a C4 column (Phenomenex Jupiter C4, 5 μm, 300 Å, 250 × 10 mm, Agilent) using an acetonitrile/water gradient containing 0.1% TFA ...
-
bioRxiv - Systems Biology 2021Quote: ... using an Aminex HPX-87H ion-exchange column operated at 60°C with 5 mM H2SO4 as the mobile phase with a flow rate of 0.6 mL min-1 (Agilent, Santa Clara). The OD660 was measured with a Jenway 7200 spectrophotometer (Jenway ...
-
bioRxiv - Microbiology 2021Quote: ... Online mass calibration was performed using a second spray needle and a constant flow (5 ul/min) of reference solution containing purine and hexakis (1H, 1H, 3H -tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). Compounds were identified based on the retention time of chemical standards and their accurate mass (tolerance 20 ppm) ...
-
bioRxiv - Microbiology 2021Quote: ... Online mass calibration was performed using a second spray needle and a constant flow (5 ul/min) of reference solution containing purine and hexakis (1H, 1H, 3H -tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). Compounds were identified based on the retention time of chemical standards and their accurate mass (tolerance 20 ppm) ...
-
bioRxiv - Plant Biology 2021Quote: ... and 0.25 μm film of 95% dimethyl/5% diphenylpolysiloxane) with a precolumn (10 m J&W integrated with Agilent 122-5532G) was used for compound separation ...
-
bioRxiv - Microbiology 2019Quote: ... Sample separation was done with a CP-PoraBOND Q column (50 m × 0.32 mm ID, 5 um film thickness; Agilent Technology, Netherlands) operated isothermally at 40°C using helium as a carrier gas at a flow rate of 2.0 ml/min ...
-
bioRxiv - Cell Biology 2021Quote: ... The reaction was quenched by addition of glycerol (5% final) and desalted using a Bond Elut SepPak C18 cartridge (Agilent, MA). Methanol was used to elute oxidized GM1 species from the column and was removed by Speed Vac concentration (Savant) ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were injected through a Zorbax Eclipse C8 4.6 x 150 mm 5 μm column (Agilent Technologies, Santa Clara, CA). Reference wavelengths for all three methods were set to 332 nm for TMZ and 273 nm for RG7388 ...
-
bioRxiv - Molecular Biology 2021Quote: ... approximately 8 µg of protein was injected on a Zorbax 300SB-C18 column (5 µm, 300Å, 1×250mm IDxL; Agilent Technologies) and separated using a 30 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Neuroscience 2022Quote: ... 3x 5 minutes) and incubated in the secondary antibody-horseradish peroxidase (HRP) complex as part of REAL EnVision detection system (Dako #K5007) for 1h at RT ...
-
bioRxiv - Biophysics 2019Quote: ... The fusion constructs were generated by deletion of amino acids from the 5-HT3A-ICD using appropriate partially overlapping primers with the QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) and were confirmed by DNA sequencing (GENEWIZ ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Samples were analyzed by UPLC-MS/MS at 5 µL injection volumes on a Zorbax RRHD Eclipse Plus C18 column (2.1×50mm, 1.8 μm; Agilent, Santa Clara, CA) using a Shimadzu Nexera X2 UHPLC (Shimadzu ...
-
bioRxiv - Plant Biology 2019Quote: ... 10 μL of each sample was injected onto a ZORBAX SB-C18 column (5 μm, 4.6 × 250 mm) (Agilent 1260, USA). The mobile phase was composed of solvent A (water ...
-
bioRxiv - Biochemistry 2020Quote: ... [45] using an Agilent 1100 HPLC system fitted with a ZORBAX Eclipse XDB analytical C18 column (4.6×150 mm, 5 μm particle size, Agilent Technologies, USA). The bacteriocin protein was eluted using a 40-min linear water-ACN gradient (increasing the gradient to 95%).
-
bioRxiv - Neuroscience 2019Quote: ... astrocytes (5×104 cells/well) were plated in a Seahorse XFe 24 microplate (Seahorse Biosciences/Agilent Technologies, Santa Clara, CA, USA) coated with 0.05mg/ml PDL and treated with 1 μM cisplatin or vehicle for 24h ...
-
bioRxiv - Immunology 2021Quote: ... sections were washed three times in 1 X PBS for 5 minutes and the sections allowed to dry slightly before mounting with DAKO mounting medium (Agilent Technologies) and allowing to airdry overnight in the dark at room temperature ...
-
bioRxiv - Molecular Biology 2019Quote: ... Tryptic peptides were re-dissolved in 10 μl 5% formic acid and 6 μl was injected onto a 50 mm 300 μm C18 trap column (Agilent Technologies) followed by an initial wash step with Buffer A (5% (v/v ...
-
bioRxiv - Cell Biology 2021Quote: ... washed three times in PBST containing 10 µg/ml DAPI for 5 minutes and mounted with a coverslip in fluorescent mounting media (Dako, S3023). All images were taken using a Zeiss LSM 710 confocal microscope and quantified manually using ImageJ software ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... and melting temperatures Tm extracted as the maxima of the first derivatives of smoothened melting curves (filter 5) using the Cary WinUV software (Version 3.0, Agilent Technologies Inc.).
-
bioRxiv - Microbiology 2021Quote: ... the fractions were injected on HPLC for purification performed on an Eclipse+ C18 column (L = 150 mm, D = 3.0 mm, Particles diameter 5 µm) (Agilent, Waldbronn, Germany). The volume injected was 100 µl ...
-
bioRxiv - Genomics 2020Quote: ... 7890A apparatus equipped with a split/splitless injector and an FID detector with an HP-5 column (J & W Scientific Columns, Agilent Technologies) 30 m × 0.32 mm and 0.25 µm film thickness.
-
bioRxiv - Molecular Biology 2020Quote: ... Scanning of the microarrays was performed with 5 µm resolution and the extended mode using a ‘High Resolution Microarray Laser Scanner’ (G2505, Agilent Technologies). Raw microarray image data were extracted and analyzed with the ‘G2567AA Image Analysis / Feature Extraction software’ (Version A.10.5.1.1 ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
bioRxiv - Biochemistry 2022Quote: ... The resulting mixture was digested with DpnI and 5 µL of the mutagenesis reaction was transformed in XL10-Gold® Ultracompetent Cells (Agilent) and selected on amplicillin-containing LB-agar plates ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were then washed and 5 × 105 osteoclasts were seeded onto a XF96 plate containing Seahorse XF RPMI medium (Agilent Technologies). The cells were left for 1 h at 37 °C after which the different metabolic drugs were injected (oligomycin 1μM ...
-
bioRxiv - Cell Biology 2022Quote: ... The absorbance was read at 450 nm (reference at 620 nm) using a Cytation 5 Cell Imaging Multi-Mode Reader (Agilent Biotek).
-
bioRxiv - Genomics 2022Quote: ... Amplified products were purified with the Zymo Research DNA Clean & Concentrator-5 kit and then analyzed for concentration and size distribution with a HSD5000 screentape (Agilent, #5067) on an Agilent 4150 TapeStation system ...
-
bioRxiv - Microbiology 2022Quote: ... peptides were resuspended in 1ml of Buffer A (5 mM ammonium formate, pH 10.5) and separated using a 1100 series HPLC (Agilent Technologies, CA) using a Gemini NX-C18 column (4.6 x 250 mm ...
-
bioRxiv - Plant Biology 2022Quote: ... The hydroxylipids were further resolved by normal-phase HPLC (Zorbax Rx-SIL column, 2.1 x 150 mm, 5 μm, Agilent, Waldbronn, Germany) a flow rate of 0.125 ml min-1 with a solvent system that contained hexane ...
-
bioRxiv - Genetics 2023Quote: ... Twenty microliters of the gliadin extracts were injected into a C18 reversed-phase Zorbax 300 StableBond column (4.6×250 mm, 5 μm, 300 Å, Agilent Technologies), maintained at 60°C ...
-
bioRxiv - Genetics 2023Quote: ... Twenty microliters of the EPP and UPP extracts were separately injected into a Bio SEC-5 column (4.6×300 mm, 500 Å, Agilent Technologies), maintained at 25°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein samples were first desalted on a reverse phase-C8 cartridge (Zorbax 300SB-C8, 5 mm, 300 µm ID’5mm, Agilent Technologies) for 3 min at a flow rate of 50 ml/min with 100% solvent A and then eluted with 70% solvent B at a flow rate of 50 ml/min for MS detection ...
-
bioRxiv - Biochemistry 2022Quote: ... C238P mutations were introduced step-wise into pDONR221-AR-AD-TAU-5* (bearing L26P, A186P, L192P and C238P mutation and previously described) using a Quickchange™ protocol with Pfu Turbo polymerase (Agilent) and the following primer pairs to generate pDONR221-AR-AD-L56P+Tau-1+Tau-5*:
-
bioRxiv - Cell Biology 2023Quote: ... frozen femur sections were blocked with 3% BSA and 5% goat serum in PBS, incubated with Cgrp antibody (rabbit polyclonal, abcam #ab47027, 1:300 in DAKO antibody diluent (Agilent, #S0809)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were washed a further three times with TBS-T for 5 minutes and stained with DAKO EnVision-HRP rabbit/mouse (Agilent; #K5007) for 2 hours at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were washed a further 3 times in TBS-T for 5 minutes and developed with DAB diluted at a 1:50 ratio in DAB-chromagen (Agilent; #K3468) until appearance of brown staining ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.