Labshake search
Citations for Agilent :
101 - 150 of 1150 citations for Borrelia burgdorferi C p Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: OpenLAB CDS ChemStation Edition software version C.01.06 (Agilent Technologies) was used to analyze GC data ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... A C-18 column (2.1 × 100 mm, 1.8μm, Agilent, Inc.) was used to perform the separation ...
-
bioRxiv - Biochemistry 2019Quote: ... Glyko® Sialidase C™ was from Prozyme (Hayward, CA). All solutions were made with ultrapure Milli-Q water (Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... ICP-MS MassHunter 4.4 software Version C.01.04 from Agilent was used ...
-
bioRxiv - Immunology 2020Quote: ... proteins were tetramerized with streptavidin-APC (Prozyme) or streptavidin-AlexaFluor488 (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Proteins were tetramerized with streptavidin-APC (Prozyme), streptavidin–Alexa Fluor 488 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Additional protein block from Dako (X090930-2) was applied ...
-
bioRxiv - Neuroscience 2023Quote: ... blocked (30 min, protein block X0909, Dako), and stained overnight at 4°C using primary antibodies detecting F4/80 ...
-
bioRxiv - Immunology 2023Quote: ... using the Protein G AssayMAP Bravo (Agilent) system ...
-
bioRxiv - Immunology 2023Quote: ... using the Protein G AssayMAP Bravo (Agilent) system ...
-
bioRxiv - Microbiology 2020Quote: ... sealed with adhesive and incubated for 10 min at 65°C and overnight at 37°C on a FISH-hybridizer (Dako; Agilent Technologies, Santa Clara, CA). The slides were then immersed in a series of baths with SSC buffer at different concentrations of 4× ...
-
bioRxiv - Bioengineering 2020Quote: ... ENVs were collected 3 days after electroporation and analyzed for miR-101-3p content by RT-PCR using the qScript microRNA cDNA Synthesis Kit (Quanta Biosciences, Beverly, MA) and SYBR Mastermix (Quanta Biosciences) on a Stratagene Mx 3000 P (Stratagene, San Diego, CA). The primer for miR-101-3p was (TACAGTACTGTGATAACTGAA) ...
-
bioRxiv - Cell Biology 2022Quote: ... 120 μL of supernatant was removed from each tube and filtered using 0.2 μm polyvinylidene fluoride filter (Agilent Technologies P/N: 203980-100) and collected via 6,000 rcf centrifuge for 4 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... and L325A—were created using plasmids harboring the wild type GNNV-P sequence and a QuickChange Lightning site-directed mutagenesis kit (Agilent Technologies, CA, USA). Mutations were confirmed by PCR sequencing (Genomics Inc. ...
-
bioRxiv - Biophysics 2021Quote: hnRNPA1* (where * denotes that the hexa-peptide 259-264 is deleted) protein and deletion constructs were expressed as N-terminally tagged hSUMO fusion proteins in BL21 (DE3) RIPL cells (Agilent) in LB media ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4°C hold) by Herculase II fusion enzyme (Agilent Technologies, #600679). After each step DNA was purified by Ampure XP beads (Beckmann Coulter Genomics #A63882) ...
-
bioRxiv - Cell Biology 2021Quote: ... overnight at 4°C after blocking with blocking solution (S3022, Dako) for 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... the photographs were taken by the C-Digit system (Agilent, USA).
-
bioRxiv - Cell Biology 2022Quote: ... Splitless injection (injection temperature 270 °C) onto a DB-5MS (Agilent) was used ...
-
bioRxiv - Immunology 2019Quote: ... and then overnight at 4°C in rabbit anti-CD3 (Dako) in 1% (v/v ...
-
bioRxiv - Genetics 2020Quote: ... at 4°C followed by secondary antibody (Dako Cytomation, Glostrup, Denmark) for 30 min at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... overnight at 4°C in Dako REAL antibody diluent (Dako, S2022). To visualized the specific signal ...
-
bioRxiv - Cell Biology 2023Quote: ... at 32°C followed by EnVision Flex+ Mouse LINKER (Dako Omnis) for 10 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4°C hold) by Herculase II fusion enzyme (Agilent Technologies, #600679). After each step ...
-
bioRxiv - Immunology 2023Quote: ... Spitless injection (injection temperature 270°C) onto a DB-5MS (Agilent) was used ...
-
bioRxiv - Genomics 2023Quote: ... and C of the XF96 sensor cartridge (102601-100, Agilent Technologies) were loaded with oligomycin (1.5µM) ...
-
bioRxiv - Genomics 2021Quote: ... A mouse monoclonal anti-p63 antibody (1:500, MS-1081-P, Neomarkers, Fremont, CA, USA) and followed by a secondary kit (Mouse Envision, DAKO-Agilent, Santa Clara CA, USA), stained with chromogen (3,3′-Diaminobenzidine [DAB] ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an additional serum-free protein block (DakoCytomation) to reduce nonspecific binding of endogenous proteins ...
-
bioRxiv - Synthetic Biology 2019Quote: ... After blocking with serum-free protein block (Dako), they were incubated with the primary antibodies for 120 min at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-glial acidic fibrillary protein (GFAP)(Dako), mouse anti-glutamic acid decarboxylase 67 (GAD67 ...
-
bioRxiv - Bioengineering 2020Quote: Proteins were expressed in BL21(DE3)Gold (Stratagene) and purified as described previously6 ...
-
bioRxiv - Biophysics 2021Quote: ... proteins were expressed using BL21(DE3) cells (Agilent). The cells were grown at 37°C until an optical density at 600nm of .6 then induced with 0.2mM isopropyl-Beta-D-thiogalactoside overnight at 18° C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein blocking was performed for 20 min (Dako). NUP210 primary antibody (Atlas ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein was overexpressed in BL21(DE3) RIL (Agilent) at 37 °C in Terrific Broth (TB ...
-
bioRxiv - Pathology 2021Quote: ... Slides were placed in a Protein Block (DAKO) for 10 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Protein-Block solution (DAKO Agilent technologies, X0909) respectively ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Protein-Block solution (DAKO Agilent technologies, X0909) respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... blocked in Dako Protein Block (Cat #X0909, Agilent), and stained by secondary antibodies (1:1000 ...
-
bioRxiv - Microbiology 2022Quote: ... The slides were blocked with protein Block (Agilent) to prevent nonspecific antibody binding ...
-
bioRxiv - Microbiology 2023Quote: ... The slides were blocked with Protein Block (Agilent) to prevent nonspecific antibody binding ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 4 was protein blocking (Background Sniper, Dako Protein Block or Normal block ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were blocked using 10% protein block (Dako) in PBS containing 0.5% Triton-X-100 for 1 h at RT ...
-
bioRxiv - Microbiology 2023Quote: ... then blocked with Dako protein block (Agilent Technologies) for 30 minutes ...
-
bioRxiv - Bioengineering 2024Quote: ... followed by protein block (X0909, Dako North America). At room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... Concentrations of extracellular metabolites and putative alcoholic contaminants of NAD(P)H substrates were analyzed by high-performance liquid chromatography (HPLC) on an Agilent 1100 HPLC (Agilent Technologies, Santa Clara, CA USA) with an Aminex HPX-87H ion-exchange column (BioRad ...
-
bioRxiv - Genomics 2021Quote: ... A mouse monoclonal anti-p63 antibody (1:500, MS-1081-P, Neomarkers, Fremont, CA, USA) and followed by a secondary kit (Mouse Envision, DAKO-Agilent, Santa Clara CA, USA), stained with chromogen (3,3′-Diaminobenzidine [DAB] ...
-
bioRxiv - Molecular Biology 2021Quote: ... at 4°C overnight diluted 1:200 in antibody diluent (#S3022, Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C for 30 min followed by HRP- labeled streptavidin (Dako) at room temperature for 30 min ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... The GC was coupled with a 5975 C mass-spectrometer (Agilent Technologies). Mass spectra were recorded with electron impact ionization at 70 eV ...
-
bioRxiv - Neuroscience 2021Quote: ... Following antigen retrieval for 15 min at 80°C (pH 6.0; DAKO), tissues were incubated in block solution containing 0.3% Triton and 10% goat serum for 1 hr at room temperature (RT ...