Labshake search
Citations for Agilent :
101 - 150 of 4443 citations for 1 3 Nitro 10 11 dihydro 5H dibenzo b f azepin 5 yl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... were changed to 5′-ACCTGCAAAG −3′ by using the Quick-Change site directed mutagenesis Kit (Stratagene, La Jolla, CA, USA). Expression vectors for SENP2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent). The same kit was used to sequentially remove three nucleotides located at the 5’ end of the pCS2+-3’HA-sobp ORF to generate a construct whose transcribed mRNA does not bind to the designed translation-blocking antisense morpholino oligonucleotide (pCS2+-sobpMOI-3’HA ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
p97/VCP induces GLI1 to control XBP1-dependent endoplasmic reticulum stress transcriptional responsebioRxiv - Cancer Biology 2021Quote: ... The cells were washed 3 times with PBS for 5 min and then incubated with a secondary antibody: Flex-HRP (EnVision System, Dako) for 30 min and washed 3 times 5 min with PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Molecular Biology 2024Quote: Serial sections of human and mouse FFPE BM biopsies were prepared at 3-5 μm thickness on coated microscope slides (Dako FLEX, Agilent) and processed for immunohistochemistry/immunofluorescent-based (IHC-IF) ...
-
bioRxiv - Biochemistry 2024Quote: ... were kept in a 5°C autosampler prior to analysis and injected onto a reverse- phase Zorbax SB-C18 column (150×3 mm, 5 μm particle size, Agilent, Santa Clara ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were amplified with 11 PCR cycles and the library size was analyzed by Agilent Tape Station (G2938-90014 ...
-
bioRxiv - Genomics 2020Quote: ... B (Cat # 720202, Agilent Inc, Santa Clara CA, USA). Vector recovery from genomic DNA ...
-
bioRxiv - Genetics 2020Quote: ... and b-OH-butyrate levels were determined by Agilent LC/MS 6410 Triple Quad system as described (Nissim et al ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Data processing: MassHunter software (v B.05.01, Agilent UK). Calibration curves were fitted using the simplest regression model to minimize back-calculated calibration standard concentration residuals over the range of study sample concentrations.
-
bioRxiv - Cell Biology 2023Quote: ... and were processed using Qualitative Analysis B.06.00 (Agilent). The peak areas of adenylates were calculated using following parameters (m/z ...
-
bioRxiv - Microbiology 2022Quote: ... The MassHunter Quantitative Analysis Software (Agilent, version B.09.00) was used for peak integration based on retention time (tolerance of 0.2 min ...
-
bioRxiv - Plant Biology 2024Quote: ... Agilent MassHunter software (B.07.01, Agilent Technologies, United States) was used for data acquisition as well as final qualitative and quantitative analysis.
-
bioRxiv - Microbiology 2024Quote: ... Agilent MassHunter version B.05.00 software (Agilent Technologies, USA) was employed for data acquisition.
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase A consisted of water with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Genomics 2024Quote: ... libraries were concentrated down to 5 µl and mixed with 10 µl of Herculase Buffer (Agilent), 5 µl of 2.5 nM dNTPs ...
-
bioRxiv - Microbiology 2020Quote: ... EnvP(b)1CS- with the furin cleavage site mutated from RKTR to SKTR was generated from the human EnvP(b)1 plasmid using QuikChange site-directed mutagenesis (Agilent). EnvP(b)1 iRBD sequences were synthesized and cloned into a modified pVRC8400 expression vector ...
-
bioRxiv - Cell Biology 2022Quote: ... Data analysis: PNGase F released free N-glycan was identified by Agilent Masshunter Quantitative Analysis software by the presence of hexose and N-acetylhexosamine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Genomics 2023Quote: ... on the DS-11 FX instrument (Denovix) and evaluation of DNA integrity on FEMTO Pulse (Agilent), 12 μg of DNA was prepared for sequencing using Megaruptor 3 shearing (Diagenode ...
-
bioRxiv - Bioengineering 2023Quote: ... and impedance was measured at 10 kHz every 5 min using the xCELLigence RTCA SP device (Agilent) as described above ...
-
bioRxiv - Plant Biology 2024Quote: ... A splitless injection volume of 1 μL was injected onto an HP-5 column with 5% phenyl methylpolysiloxane stationary phase (Agilent) with dimensions of 30 m x 0.25 mm x 0.25 μm ...
-
bioRxiv - Plant Biology 2020Quote: For data deconvolution the software Profinder B.08.02 (Agilent Technologies) was used ...
-
bioRxiv - Biochemistry 2020Quote: ... we used Masshunter Qualitative Analysis version B.07 (Agilent Technologies) and the Molecular Feature Extraction tool to extract H+ ...
-
bioRxiv - Biochemistry 2021Quote: ... Data were acquired using Profinder B.08.00 SP3 software (Agilent). Intracellular relative abundance of metabolites was normalized to cell number for GC/MS samples or by total ion current (TIC ...
-
bioRxiv - Immunology 2021Quote: ... MassHunter B.06.01 software (Agilent Technologies, Santa Clara, CA, USA) was used for all data acquisition ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... MassHunter B.06.01 software (Agilent Technologies, Santa Clara, CA, USA) was used for all data acquisition and MZmine 2 was used for data processing.
-
Changes in cell morphology and function induced by NRAS Q61R mutation in lymphatic endothelial cellsbioRxiv - Cell Biology 2023Quote: ... The systems were controlled by Agilent G2201AA ChemStation software version B.03.01 for CE (Agilent Technologies) and connected by a fused silica capillary (50 μm i.d ...
-
bioRxiv - Cell Biology 2023Quote: ... The systems were controlled by Agilent G2201AA ChemStation software version B.03.01 for CE (Agilent Technologies) and connected by a fused silica capillary (50 μm i.d ...
-
bioRxiv - Physiology 2023Quote: ... and were processed using Qualitative Analysis B.06.00 (Agilent Technologies). Levels of AMP ...
-
bioRxiv - Physiology 2023Quote: ... and were processed using Qualitative Analysis B.06.00 (Agilent Technologies). Levels of AMP ...
-
bioRxiv - Physiology 2023Quote: ... and were processed using Qualitative Analysis B.06.00 (Agilent Technologies).
-
bioRxiv - Biochemistry 2022Quote: ... M/z spectra were analysed using Masshunter B.07.00 (Agilent); ESIprot (49 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The data was analyzed using MassHunter (Agilent version B.07.00). The retention times (RT ...
-
Macrodomain Mac1 of SARS-CoV-2 Nonstructural Protein 3 Hydrolyzes Diverse ADP-ribosylated SubstratesbioRxiv - Biochemistry 2023Quote: ... MassHunter Qualitative Analysis Version B.07 (Agilent Technologies, CA, USA). Spectral matching of obtained MS/MS spectra was performed with spectral libraries Human Metabolome Database (HMDB ...
-
bioRxiv - Microbiology 2024Quote: ... Data processing was performed using MassHunter BioConfirm B.08.00 (Agilent), and spectral deconvolution was carried out using MaxEnt.
-
bioRxiv - Microbiology 2020Quote: ... bacteria were incubated with FITC-conjugated goat F(ab’)2 anti-mouse (Dako), diluted 1/100 in RPMI-H.
-
bioRxiv - Immunology 2021Quote: ... 150 μg of antibody was digested with PNGase F (Prozyme, Hayward, CA, USA) to liberate glycans ...
-
bioRxiv - Bioengineering 2024Quote: ... and reverse primer (5’-AGGTCATGTACTGGGCATAAT-3’) binding to the GFP sequence with 5 µL of Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies, USA) and 0.15 µL of 2 µM reference dye.
-
bioRxiv - Molecular Biology 2024Quote: Serial sections of human and mouse FFPE BM biopsies were prepared at 3-5 μm thickness on coated microscope slides (Dako FLEX, Agilent) and processed for immunohistochemistry/immunofluorescent-based (IHC-IF) ...