Labshake search
Citations for Agilent :
251 - 300 of 4443 citations for 1 3 Nitro 10 11 dihydro 5H dibenzo b f azepin 5 yl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... in 3 cycles for 3 hours using the Seahorse XFe24 analyzer system (Agilent Technologies). Inhibitors and substrates were used at the following concentrations ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... After irradiation the sample was combined with 10 µl of formic acid 1 % and 10 µl analyzed by LC-MS using an Ultimate 1100 HPLC system (Agilent Technologies) connected to an Amazon Speed ETD ion-trap mass spectrometer (Bruker Daltonics) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Integrin α11 expression levels were detected by rabbit polyclonal antibodies to human or mouse integrin α11 (provided by Donald Gullberg, Department of Biomedicine, University of Bergen, Norway) and the polyclonal anti-rabbit immunoglobulins/HRP (Dako). Images were analyzed using the gel analyzing tool by ImageJ ...
-
bioRxiv - Systems Biology 2022Quote: The quantity and quality of the RNA was measured using both a spectrophotometer (DS-11, DeNovix, Wilmington, Delaware, USA) and Fragment Analyser (Agilent). 4 μg of RNA was treated with DNAse1 (Thermo ...
-
bioRxiv - Genetics 2024Quote: ... The BP-lowering rs1173771 haplotype was then constructed by site directed mutagenesis at the 11 SNPs locations in the haplotype using QuikChange II Site-directed mutagenesis kit (Agilent) and confirmed by Sanger sequencing ...
-
bioRxiv - Biochemistry 2024Quote: ... The absorbance at 570 nm was measured using a Synergy H1 Hybrid Multi-Mode Reader (Agilent, Cat#11-120-531). WT cells treated with DMSO were used as a reference for data normalization (as in (53)).
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm column (Agilent), column temperature 50 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... Spectra were analyzed with MassHunter Workstation Qualitative Analysis software version B.06.00 (Agilent).
-
bioRxiv - Plant Biology 2021Quote: The metabolomics dataset was interpreted in Mass Profiler Professional B.12.06 (Agilent technologies). Abundance was Log2 transformed and normalized at 75th percentile and baselined against the median ...
-
bioRxiv - Plant Biology 2021Quote: ... The MassHunter Workstation Software Qualitative analysis Version B.05.00 (Agilent Technologies, Inc. 2011) was used for visualizing the chromatograms and peak integration ...
-
bioRxiv - Molecular Biology 2022Quote: ... using a Prime-It Flour Fluorescence labelling kit (300380 version B, Agilent Technologies) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... MS spectra were processed using MassHunter Bioconfirm software (v B.10.0, Agilent Technologies) with a deconvolution range of 10-50 kDa ...
-
bioRxiv - Microbiology 2023Quote: ... Chromatograms were analysed with MassHunter Qualitative Analysis B.07.00 software (Agilent Technologies®) and the quantification of DAPG and other PGCs was done according to a standard curve with commercial PGCs.
-
bioRxiv - Plant Biology 2023Quote: ... Data acquisition and processing was done with Mass Hunter software B.08 (Agilent).
-
bioRxiv - Neuroscience 2022Quote: ... High resolution MS data were analyzed using MassHunter Qualitative Analysis B.07.00 (Agilent). MS files were converted to MGF format using Proteowizard’s MSConvert tool (Chambers et al. ...
-
bioRxiv - Biochemistry 2024Quote: ... The systems were controlled by MassHunter software version B.08.00 (Agilent Technologies Inc.).
-
bioRxiv - Molecular Biology 2024Quote: ... 1μL sample was injected into using automatic sampler (7683 B series, Agilent Technologies) in a splitless mode ...
-
bioRxiv - Immunology 2023Quote: 0.5 million B cells were cultured in assay media (XF base medium (Agilent), 200 mg glucose ...
-
bioRxiv - Cell Biology 2024Quote: ... Data was processed using MassHunter v B.07.00 (Agilent Technologies, Santa Clara, CA). Absolute quantification ...
-
bioRxiv - Biochemistry 2020Quote: The peptide was purified by high-performance liquid chromatography (HPLC) on a C4 column (Phenomenex Jupiter C4, 5 μm, 300 Å, 250 × 10 mm, Agilent) using an acetonitrile/water gradient containing 0.1% TFA ...
-
bioRxiv - Plant Biology 2021Quote: ... and 0.25 μm film of 95% dimethyl/5% diphenylpolysiloxane) with a precolumn (10 m J&W integrated with Agilent 122-5532G) was used for compound separation ...
-
bioRxiv - Cell Biology 2021Quote: ... washed three times in PBST containing 10 µg/ml DAPI for 5 minutes and mounted with a coverslip in fluorescent mounting media (Dako, S3023). All images were taken using a Zeiss LSM 710 confocal microscope and quantified manually using ImageJ software ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were suspended in a 4M urea buffer containing ampholytes and subjected to off-gel IEF fractionation using a 24 well strip (pH 3-10) (Agilent, 3100 Off- gel fractionator). Following IEF ...
-
bioRxiv - Microbiology 2021Quote: ... The 5-AIQC-tagged samples (1 μL) were individually injected on an UPLC column (Agilent ZORBAX RRHD Eclipse XDB C18 column ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-mouse IgG (1.3 μg ml−1, 5% milk in PBST; Dako, P026002-2) or goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Genomics 2024Quote: ... 87.5 μl of 10 mg ml−1 boiled salmon sperm DNA (Agilent Genomics) was added to each tube with 1.75 μg of plasmid library ...
-
bioRxiv - Genetics 2020Quote: ... Captured libraries were amplified in 3×100 μl reactions containing 1 unit Herculase II Fusion DNA polymerase (Agilent), 1x Herculase II reaction buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... All aqueous solutions in this assay were manipulated by a Velocity 11 Bravo liquid handler (Agilent Automation Solutions, Santa Clara, CA). The final volume in the assay plate was 25 ul ...
-
bioRxiv - Genomics 2021Quote: ... The quality and quantity of treated RNA were analyzed using a DeNovix DS-11 spectrophotometer (DeNovix Inc.) and the Bioanalyzer 2100 system (Agilent Technologies) with an RNA integrity number ≥ 6 for cDNA library preparation ...
-
bioRxiv - Microbiology 2024Quote: Mass spectrometry data acquisition was performed using a Bruker Daltonics Maxis II HD qTOF mass spectrometer equipped with a standard electrospray ionization (ESI) source as previously described.(11) The mass spectrometer was tuned by infusion of Tuning Mix ESI-TOF (Agilent Technologies) at a 3 µL/min flow rate ...
-
bioRxiv - Genetics 2021Quote: ... Two oligos (F: GCGATGCCACCTAGGGCAAGCTGACCCTG and R: CAGGGTCAGCTTGCCCTAGGTGGCATCGC) were used with the QuikChange II mutagenesis kit (Agilent, 200523). We confirmed that this mutation (GFPstop ...
-
bioRxiv - Microbiology 2020Quote: Each ELV and MV preparation were reconstituted in 10 μl of 5% formic acid and injected onto a 50 mm 300 μm C18 trap column (Agilent Technologies, USA). The samples were then desalted for 5 min at 30 μl/min using 0.1% formic acid and the peptides were then eluted onto an analytical nano-HPLC column (150 mm × 75 μm 300SBC18 ...
-
bioRxiv - Neuroscience 2024Quote: ... fibroblasts were seeded at 45 × 103 cells per well (5-10 replicates per cell line) in fibroblast growth media in a Seahorse XFe24 Microplate (Agilent, 100777-004) and incubated for 24 hours to allow cells to adhere ...
-
bioRxiv - Bioengineering 2023Quote: ... were obtained by high pressure liquid chromatography on an Agilent Bio SEC-5 500 Å (for KWOCA assemblies) or 1000 Å column (for I32-10) (Agilent) at a flow rate of 0.35 mL/min by injection of 10 μL of purified eluate using a mobile phase of Tris-buffered saline (50 mM Tris pH 8 ...
-
bioRxiv - Biochemistry 2020Quote: ... The samples were incubated for at least 20 min at 25°C before 10 μl were injected onto a SEC-3 HPLC column (300 Å pore size; Agilent Technologies, Santa Clara, CA) equilibrated with SEC buffer ...
-
bioRxiv - Bioengineering 2022Quote: ... Gas chromatograms were evaluated with MassHunter Workstation software version B.08.00 (Agilent Technologies, USA).
-
bioRxiv - Synthetic Biology 2022Quote: Gas chromatograms were evaluated with MassHunter Workstation software version B.08.00 (Agilent Technologies, USA). The NIST library (National Institute of Standards and Technology ...
-
bioRxiv - Cell Biology 2022Quote: ... Raw data files were processed using Profinder B.08.00 SP3 software (Agilent Technologies, CA) with an in-house database containing retention time and accurate mass information on 600 standards from Mass Spectrometry Metabolite Library (IROA Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... Data acquisition was controlled by Mass-Hunter workstation data acquisition software (B.08.01, Agilent). The mobile phases used for liquid chromatography included buffers A (Milliq water/0.1% FA ...
-
bioRxiv - Bioengineering 2020Quote: ... MS spectra were processed using MassHunter Qualitative Analysis software (v B.07.00, Agilent Technologies) with deconvolution range of 10-50 kDa ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Peak areas were determined by integration using Masshunter Workstation Qualitative Analysis B.07.00 (Agilent). To quantify preburnettiene B (1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... All analyses were performed in positive ion mode and MassHunter B.06.01 (Agilent Technologies) was used for all data acquisition ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... and quantification with MassHunter Workstation Quantitative Analysis Software (B.09.00, Agilent Technologies, California, USA).
-
bioRxiv - Plant Biology 2023Quote: ... all data processing was performed using the Agilent MassHunter Profinder version B.10.00 (Agilent Technologies Inc. ...
-
bioRxiv - Bioengineering 2023Quote: ... driven by a function generator (33500 B Series, Agilent Technologies, Santa Clara, CA, USA) through a 50-dB amplifier (E&I ...
-
bioRxiv - Neuroscience 2023Quote: ... Raw data files were processed using Mass Hunter Quantitative analysis (B.07.00, Agilent Technologies) software ...
-
bioRxiv - Physiology 2023Quote: ... all data processing was performed using the Agilent Masshunter Profinder version B.08.00 (Agilent Technologies Inc. ...
-
bioRxiv - Neuroscience 2024Quote: ... and submitted to statistical analysis using Mass Profiler Professional (Version B.14.5, Agilent Inc.) applying the condition that at least 80% of samples have the analytical signal in at least one of four types of diet plasma samples ...
-
bioRxiv - Synthetic Biology 2024Quote: ... MS data were acquired with MassHunter Workstation Data Acquisition (Version B.06.01, Agilent Technologies) and analyzed using MassHunter Qualitative Analysis (Version 10.0 ...