Labshake search
Citations for Agilent :
1101 - 1150 of 6160 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... of WRN was amplified by PCR from the pCMV-FlagWRN plasmid or from the pCMV-FlagWRNS1133D mutant The PCR product were subsequently purified and sub-cloned into pGEX4T-1 vector (Stratagene) for subsequent expression in bacteria as GST-fusion proteins ...
-
bioRxiv - Biochemistry 2023Quote: ... Site-directed mutagenesis was performed based on PCR of the full-length plasmid by using Pfu Turbo DNA polymerase (Stratagene). The entire cDNA was sequenced ...
-
bioRxiv - Cancer Biology 2023Quote: ... Number of pre-capture PCR cycles was 8 - 14 based on input DNA quantity and quality (assessed by Agilent TapeStation) as advised by the manufacturers’ protocol and run on an AB Veriti 96-well Thermocycler (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... qRT-PCR was carried out using 10-fold diluted cDNA and Brilliant II SYBR Green qPCR Master Mix (Agilent, 600828) with the appropriate primer pairs (listed in Supplementary Table 3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The adapter-modified DNA fragments were enriched by 4 cycles of PCR using SureSelect forward and SureSelect ILM Pre-Capture Indexing reverse (Agilent) primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... The purified capture products was then amplified using the SureSelect Post-Capture Indexing forward and Index PCR reverse primers (Agilent) for 12 cycles ...
-
bioRxiv - Immunology 2023Quote: ... PCR products of enhancers were amplified in a mix of PfuUltra DNA Polymerase (600385-51, Agilent Technologies, Santa Clara, CA) and Taq DNA polymerase (M7123 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and all RT-qPCR reactions were performed on an AriaMx Real-Time PCR System instrument (Agilent Technologies Santa Clara, California). Thermal cycling conditions were as follows:
-
bioRxiv - Microbiology 2023Quote: ... of HIV-1 were amplified by PCR using KOD-Plus-Neo and pNL4-3 as a template and cloned into pBluescript II KS(-) (212208, Agilent). The MLV 5’-LTR (1 - 207 nt ...
-
bioRxiv - Microbiology 2023Quote: ... pBS-UGI-flag was constructed by amplifying the UGI and flag sequence from UGI- pFERp44 by PCR and cloning it into the NotI and EcoRI sites of pBluescript II KS(+) (Stratagene). pAAV-UGI was constructed by cloning the entire coding sequence of UGI amplified from pBS-UGI-flag by PCR using the primers shown in S-Table 3 into the EcoRI and BamHI sites of pAAV-ZsGreen1 (TaKaRa).
-
bioRxiv - Evolutionary Biology 2023Quote: ... Then quantification of viral copy numbers was carried out in duplicate by quantitative PCR using a Mx3005 P Thermocycler (Agilent) as described by [49] ...
-
bioRxiv - Cancer Biology 2023Quote: ... The final libraries were generated by PCR amplification using PfuTurbo Cx Hotstart DNA polymerase (Agilent technologies, Santa Clara, CA, USA). RRBS libraries were analyzed by an Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: Genes of interest were PCR cloned from either cDNA or gDNA of N2 Bristol strain using PfuUltra II Fusion HS DNA polymerase (Agilent). Amplicon was ligated into pSM vector backbone for expression in C ...
-
bioRxiv - Microbiology 2023Quote: ... The transformation reactions were plated on LB-carbenicillin agar plates and colonies screened by PCR using Herculase II Fusion Pfu DNA Polymerase (Agilent) followed by Sanger sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... The samples quantity and purity were determined using a NanoDrop spectrophotometer while the 4C PCR library efficiency and the absence of primer dimers were reconfirmed by Agilent Bioanalyzer ...
-
bioRxiv - Systems Biology 2023Quote: ... a pool of sgRNA-encoding inserts was generated by PCR amplification with primers oJMP697 and oJMP698 from a 78-nt custom oligonucleotide library (2020-OL-J, Agilent) with the following conditions per 500 µl reaction ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was amplified by PCR using the primers with Herculase II Fusion DNA polymerase (Agilent Technologies, Santa Clara, CA, USA). PCR products were separated by electrophoresis through a 2% agarose gel in 1× TBE and stained with GelRed (Biotium ...
-
bioRxiv - Cancer Biology 2023Quote: Mitochondrial DNA copy number was quantified by qPCR on total DNA from gastrocnemius muscle using MxPro Mx3000P real-time PCR Analyzer (Agilent technologies / Stratagene) and determining the mtDNA/nDNA ratio ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNA obtained from cell cultures transfected with the RNP complex was amplified by nested PCR using Herculase II Fusion DNA Polymerase (Agilent). The first amplification was performed with primers IG36 and IG37 as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... The qRT-PCR analysis was carried out using the Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies) with 40 cycles of 20s at 95°C and 20s at 60°C ...
-
bioRxiv - Biophysics 2023Quote: ... The His-TEV-mRaichu coding sequence was amplified by PCR using the primers GACGAATTCATGAATCACAAAGTGCATCAT and CTCGACAAGCTTTTAGATTCTGTGCTTTTAAGC and was inserted into the SmaI site of pBCKS (Stratagene). The coding sequence in the resultant plasmid was subcloned into the pFastBac™ Dual Expression Vector (Thermo Fisher ...
-
bioRxiv - Genomics 2024Quote: ... each library underwent a reconditioning PCR to reduce heteroduplexes: libraries were concentrated down to 5 µl and mixed with 10 µl of Herculase Buffer (Agilent), 5 µl of 2.5 nM dNTPs ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR mixes were made up as follows in a total volume of 50 µL: 1X Pfu reaction buffer (Agilent, #600250), 0.2 mM dNTP (NEB® ...
-
bioRxiv - Molecular Biology 2024Quote: ... pB-T-PAF-Clu-TL1 was obtained by PCR-amplification of the entire plasmid with the mutagenic primers using Herculase-II (Agilent), followed by ligation with the KLD enzyme mix (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... The following qRT-PCR was conducted in biological and technical triplicates with the Brillant II SYBR Green QPCR Master Mix (#600828, Agilent) in the Stratagene Mx3005 device (Agilent) ...
-
bioRxiv - Microbiology 2024Quote: The archived samples of DNA extracts were tested for endogenous KoRV-5’ using an AriaMx real-time PCR system (Agilent) with recKoRV_200 primers under the optimised conditions (see results) ...
-
bioRxiv - Plant Biology 2024Quote: ... above in the pBKS backbone were either linearized by an AscI/PacI double digestion or by PCR amplification (Herculase II Fusion DNA Polymerase, Agilent). In parallel ...
-
bioRxiv - Molecular Biology 2024Quote: ... The quantitative PCR was executed with 1x Brilliant III Ultra-Fast SYBR Green QPCR Master mix (Agilent, Cat. No. 600882) in the Rotor-Gene 6200 real-time system ...
-
bioRxiv - Microbiology 2024Quote: Sequences coding for Fab fragments were obtained by inserting stop codons on genes corresponding to heavy chains of the mAbs by PCR using site directed mutagenesis (Quickchange II, Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The PCR-amplified library was purified using Ampure XP beads and its quality was assessed on a Bioanalyzer 2100 system (Agilent). Diluted libraries were clustered on a pair-read flowcell and sequenced using a NovaSeq 6000 system (Illumina ...
-
bioRxiv - Plant Biology 2024Quote: ... and 1.5 μl of this dilution was added to 5 μl of qRT-PCR Brilliant III SYBR Master Mix (Agilent Technologies). Quantitative Real-time PCR (qRT-PCR ...
-
bioRxiv - Cell Biology 2024Quote: Liver tissue was used to extract the DNA following the phenol-chloroform extraction method and genome DNA was used for real-time PCR amplification with Brilliant II SYBR Green QPCR master mix (Stratagene) on the Mx3000p Real-Time PCR System (Stratagene).The primers for measure the telomere repeat were (forward ...
-
bioRxiv - Genetics 2024Quote: ... Real time PCR was performed using BioRad iTaq Universal SYBR-green Supermix (Cat.No. 172–5120) in a MX3000P (Agilent Technologies) apparatus using the following program ...
-
bioRxiv - Cell Biology 2024Quote: ... Fluorescence was monitored with excitation and emission filters set at 465 and 590 nm during gradual heating (1 K/min) from 25 °C to 95 °C in a MX3005P real-time PCR instrument (Stratagene). Data was evaluated using MXPro3005 software (Stratagene ...
-
bioRxiv - Cell Biology 2024Quote: ... Real-time quantitative PCR was performed using the Stratagene Mx3005P System and Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent). GAPDH mRNA levels were used as control for normalization ...
-
bioRxiv - Developmental Biology 2024Quote: ... homology arms covering about 1.2kb of sequence around the Ehmt2 stop codon were PCR-amplified from KH2 genomic DNA and cloned into pBluescript (Stratagene) vector together with an FKBP12F36V-2xHA-P2A-NLS-mCherry cassette ...
-
bioRxiv - Cancer Biology 2021Quote: ... Immunohistochemical reaction was developed using 3, 30-diaminobenzidine tetrahydrochloride (DAB) or Purple Kit (Chromo Map DAB or Purple Kit, Ventana, Roche; DAB (Dako) and nuclei were counterstained with Carazzi’s hematoxylin ...
-
bioRxiv - Genomics 2020Quote: ... The resulting PCR product was purified using the NucleoSpin Gel and PCR Clean-up kit (Machery Nagel) and the correct fragment size was confirmed using a High Sensitivity Bioanalyzer DNA Kit (Agilent). For cloning ...
-
bioRxiv - Cell Biology 2021Quote: RNA quantity was determined on the Qubit using the Qubit RNA Assay Kit (Life Tech) and RNA quality was determined on the Bioanalyzer using the RNA Pico Kit (Agilent). Using the NEB Next Ultra RNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... The BAMfile used for IGV visualization was generated from WES data obtained with the SureSelect Human All Exon V6 kit (exome capture kit) from Agilent. Group alignment is by chromosome of mate ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL of each PCR reaction was electrophoresed using the ZAG 130 dsDNA Kit (75-20000 bp) or ZAG 110 dsDNA Kit (35-5000 bp) (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... libraries were quantified with qPCR using the NEBnext Library Quant Kit for Illumina and fragment size assessed with TapeStation D1000 kit (Agilent). Libraries were pooled in equimolar concentration and sequenced using an Illumina NovaSeq 6000 and S2 flow cells (100 cycle kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... hEZH2-K381R-Fv: GGAGCTATGATGCTAGATTCCTTGACTCTAAACTCATACAC and hEZH2-K381R-Rv: GTGTATGAGTTTAGAGTCAAGGAATCTAGCATCATAGCTCC with site-directed mutagenesis kit (QuikChange II Site-directed mutagenesis kit, Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Real-time changes in metabolism were tested using a Seahorse XFe96 Analyzer in conjunction with the Seahorse XF Glycolysis Stress Test Assay Kit and the Seahorse XF Real-time ATP Assay Rate Kit (Agilent). Manufacturer instructions were followed to perform each of the assays ...
-
bioRxiv - Cell Biology 2020Quote: ... After a cleanup with SPRIselect Reagent Kit and fragment size estimation with High SensitivityTM HS DNA kit runned on 2100 Bioanalyzer (Agilent), the libraries were constructed by performing the following steps ...
-
bioRxiv - Microbiology 2020Quote: ... A series of alanine mutants were introduced into the SARS-CoV-2 spike protein using the QuickChange mutagenesis kit or the QuickChange multi-mutagenesis kit (Agilent). The primers for mutagenesis were designed on Agilent’s website (https://www.agilent.com/store/primerDesignProgram.jsp) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Final Hi-C libraries were quantified using Qubit dsDNA HS assay kit and a DNA HS kit on a 2100 Bioanalyzer (Agilent). Libraries were first shallow sequenced on an Illumina MiSeq (2×84bp paired-end ...
-
bioRxiv - Developmental Biology 2021Quote: ... or deletions in full-length Gpr161 were generated using Quikchange site-directed mutagenesis kit (Stratagene or Q5 Mutagenesis Kit (NEB).
-
bioRxiv - Genomics 2022Quote: ... Libraries were quantified with Qubit dsDNA HS Assay kit and visualized with Standard Sensitivity NGS Fragment Analysis Kit (Advanced Analytical DNF-473) and Fragment Analyzer 5200 (Agilent). Libraries were sequenced using Illumina NovaSeq flowcell with 100 bp single-end runs.
-
bioRxiv - Neuroscience 2022Quote: ... cDNA libraries were prepared using a QuantSeq 3’ mRNA-Seq Library Prep kit FWD (Lexogen) and a qPCR add-on kit after which they were run on a Fragment Analyzer (Agilent), equimolar pooled and sequenced using an Illumina NextSeq 500/550 High Output Kit v2.5 (75 Cycles) ...