Labshake search
Citations for Agilent :
1001 - 1050 of 6160 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid point mutations were generated using Pfu Ultra polymerase by Quick Change PCR mutagenesis (Agilent Technologies, Santa Clara, CA). The resulting DNA constructs and strains were verified by DNA sequencing.
-
bioRxiv - Plant Biology 2021Quote: ... The genomic SPL7 (AT5G18830.1) coding region (translational start to stop codon) was PCR-amplified and cloned into the pBluescript SK+ vector (Stratagene/Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... 73 and it was used to introduce the different point mutations in MAGI1 by mutagenesis PCR using PfuTurbo (Agilent). All the Gateway destination vectors are listed in the supplementary methods ...
-
bioRxiv - Molecular Biology 2022Quote: ... the glnA gene was amplified by PCR using the PfuUltra high-fidelity DNA polymerase AD from Agilent (CAT#600385) and the following specific primers ...
-
bioRxiv - Microbiology 2022Quote: Single-base alterations to plasmid sequences were performed using a PCR technique based on QuikChange site-directed mutagenesis (Stratagene).
-
bioRxiv - Cell Biology 2022Quote: ... Triplicate reactions were set up in Semi-skirted 96-Well PCR Plates (0.2 ml) with optical strip caps (Agilent). The PCR reactions were carried out in an AriaMx Real-time PCR System (Agilent) ...
-
bioRxiv - Microbiology 2021Quote: ... Cassettes and the template plasmid pM07704 were amplified by polymerase chain reaction (PCR) with Herculase II DNA polymerase (Stratagene). Marker-exchange plasmids were generated by ligation of the PCR products in α-select cells (Bioline ...
-
bioRxiv - Microbiology 2020Quote: ... Abundances of bacterial 16S rRNA genes were determined by quantitative PCR using Brilliant SYBR Green II Mastermix (Agilent Technologies) on a Mx3000P system (Agilent Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... was ligated into pCMV6-AC-HIS vector following incorporation of flanking restriction enzyme sites by PCR (SgfI AGGCGATCGCCATGAGCTGGGTGCAGGTCAACTT, MluI – GCGACGCGTACTTTGCCCCTGCTGCTGCTCTG) and grown in XL-10 Gold E.Coli (Agilent). Site directed mutagenesis (Q5-SDM – NEB ...
-
bioRxiv - Neuroscience 2020Quote: ... nucleotides: 907-1550) was amplified by the use of polymerase chain reaction (PCR) and cloned into pBluescript KS+ (Stratagene) via ClaI-EcoRI sites ...
-
bioRxiv - Biochemistry 2021Quote: Mutagenic PCR was used to introduce point mutations in both PgDHAR and HsCLIC1 (Table S2) following manufacturers protocol (Stratagene). 2-5μl of the PCR product was used to transform E ...
-
bioRxiv - Genomics 2021Quote: PCR was performed from each DNA sample for four regions (ORF21, ORF34, ORF46, and ORF18) using Herculase II (Agilent). Each region was then PCR purified (GeneJet ...
-
bioRxiv - Cell Biology 2021Quote: ... was used according to manufacturer’s instructions and the samples were run in triplicate on the AriaMx Real-time PCR System (Agilent). Relative quantification was performed using the 2-ddct method ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR products were purified using the AMPure XP system and resulting libraries were analysed for size distribution by Agilent 2100 Bioanalyzer ...
-
bioRxiv - Genomics 2022Quote: ... We then PCR-amplified directly from the beads using the SureSelectXT-LI Primer Mix (Agilent Technologies, Santa Clara, CA), using the same PCR conditions described above for library preparation except with a 14-cycle parameter to increase the concentration of the capture library ...
-
bioRxiv - Microbiology 2022Quote: ... We then amplified 3 µL of cDNA (10 ng/µL) in Power SYBR (Thermo) with 1.6 µM primers using the AriaMx real-time PCR system (Agilent) in a volume of 12 µL ...
-
bioRxiv - Molecular Biology 2022Quote: ... Mutagenesis was achieved by overlapping extension PCR using the Pfu Turbo® DNA polymerase (Stratagene, La Jolla, CA, USA). For the split luciferase experiments ...
-
bioRxiv - Plant Biology 2022Quote: ... All the qRT-PCR reactions were run on a Stratagene Mx 3005P apparatus (Agilent Technologies, Santa Clara, CA, USA) using the 5x HOT FIREPol® EvaGreen® qPCR Supermix kit (Solis BioDyne ...
-
bioRxiv - Cell Biology 2022Quote: ... The P937R mutation (c.C2810G) was introduced in the long homology arm by PCR-mediated mutagenesis (Quik-Change Lightning, Agilent), using the following primers ...
-
bioRxiv - Immunology 2023Quote: ... The cDNA content of pre-fragmentation and post-sample index PCR samples was analyzed using the 2100 BioAnalyzer (Agilent). Sequencing libraries were loaded on an Illumina Illumina NovaSeq 6000 flow cell ...
-
bioRxiv - Microbiology 2023Quote: ... PCR amplification of pcDNA3.1-NS3-mCherry-HIS plasmid was done by using PfuUltra HotStart DNA Polymerase (Agilent, Cat #: 600390) and forward and reverse primers (table 2 ...
-
bioRxiv - Microbiology 2022Quote: ... The plate was then exposed to a temperature gradient for 3 min in a PCR machine (Agilent SureCycler 8800), followed by 3 min at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... and PCR products were purified with VAHTS DNA Clean Beads (Vazyme) and quantified using Qubit and 2100 Bioanalyzer (Agilent). The Ccna2 ...
-
bioRxiv - Biophysics 2023Quote: Drp1 isoform 1 (Genbank accession number AB006965) was PCR amplified with Pfu Turbo DNA polymerase (Stratagene, La Jolla, CA) as an NdeI/XhoI fragment ...
-
bioRxiv - Neuroscience 2023Quote: ... nucleotides 214–990) was amplified by PCR and cloned into the pBluscript II KS (−) plasmid (Stratagene, La Jolla, CA). Antisense RNAs were synthesized from linearized plasmids using T3 RNA polymerase (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... vRNA and gDNA were both amplified by PCR using R1_forward primer and R1_Reverse primer using Herculase II Fusion DNA Polymerase (Agilent, 600677). PCR products were cleaned up using the QIAquick PCR clean up kit (Qiagen ...
-
bioRxiv - Genetics 2023Quote: ... The PCR amplifications were performed with Herculase II fusión DNA Polymerase following supplier recommendation (Agilent, Santa Clara, CA, USA).
-
bioRxiv - Cell Biology 2023Quote: ... or directly processed by RT-qPCR using Brilliant III Ultra-Fast SYBR Green QRT-PCR Master Mix (Agilent Technologies), using primers designed with SnapGene® (version 6.1.1 ...
-
bioRxiv - Genomics 2022Quote: ... The sizes of mRT-PCR products were evaluated and amplicons were quantified on a TapeStation device (Agilent, CA, USA). Equal amounts of RT-PCR products from two reactions per sample were pooled together for downstream NGS library preparation and sequencing.
-
bioRxiv - Microbiology 2023Quote: ... Real-time Polymerase Chain Reaction (qPCR) was conducted in a Stragene Mx3005P real-time PCR system (Agilent Technologies®) to analyze the relative expression of the cytokine genes Interleukin 2 (IL-2) ...
-
bioRxiv - Neuroscience 2023Quote: ... The cDNA content of pre-fragmentation and post-sample index PCR samples was analyzed using the 2100 BioAnalyzer (Agilent). Sequencing libraries were loaded on an Illumina NovaSeq flow cell at VIB Nucleomics core with sequencing settings (Supplementary Table 3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each deletion or mutant was produced by PCR using Pfu Ultra Ⅱ Fusion HS DNA Polymerase (Agilent Technology 600670). Vectors were transfected into T7 Express lysY Competent E ...
-
bioRxiv - Plant Biology 2024Quote: ... and qRT–PCR experiments were performed with the “Brilliant III Ultra-Fast SYBR Green QPCR Master Mix” (Agilent Technologies) according to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2024Quote: All PCR reactions were completed using a 50 ul reaction containing: 0.5 ul PFuUltra II fusion HS DNA Polymerase (Agilent), 1 % PFu Ultra reaction buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR products were purified (AMPure XP system) and library quality was assessed on the Agilent 5400 system(Agilent,USA) and quantified by QPCR (1.5 nM) ...
-
bioRxiv - Genetics 2024Quote: ... Reactions were set up in optical PCR tubes and run on an AriaMX Real-Time qPCR cycler (Agilent, USA) with Fam and Hex filters ...
-
bioRxiv - Plant Biology 2024Quote: ... and melting curves from 65°C to 95°C in increments of 0.5°C (AriaMx Real-time PCR machine, Agilent). Cycle threshold values (Ct ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Primers and gBlocks were ordered from Integrated DNA technologies (IDT) and PCR reactions were performed with Herculase II (Agilent) or Phusion DNA polymerase (New England BioLabs ...
-
bioRxiv - Biophysics 2024Quote: ... The PCR product was digested overnight with DpnI at 37°C and transformed into XL1-Blue Supercompetent cells (Agilent) and the mutation was confirmed by sequencing (Eurofins Genomics) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Each input was amplified and sequenced from three independent PCRs [7 cycles each using Taq Precision Plus (Agilent Technologies)] ...
-
bioRxiv - Microbiology 2020Quote: ... The quantity and size distribution of the RNA and DNA were determined by Agilent Bioanalyzer 2100 with an RNA 6000 Pico Kit and a DNA 1000 kit (Agilent Technologies, Santa Clara, CA, USA).
-
bioRxiv - Microbiology 2022Quote: ... Site-directed NS1 mutants were produced using a site-directed mutagenesis kit (QuikChange XL Site-Directed Mutagenesis Kit, Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and generic real-time reverse-transcription PCR (RT-qPCR) as previously published (29) in AriaMx real-time cycler (Agilent, Germany). Standard curves generated by serial dilutions of B_NS217 (10 to 100000 pfu ...
-
bioRxiv - Biochemistry 2022Quote: ... a DNA fragment spanning PasI and DraIII sites of pCAG-MV-GagPol-CTEx2 was PCR-amplified and ligated between BamHI and XhoI sites of pBluescript II KS(+) (Stratagene). AgeI and XhoI restriction sites flanking the IN-coding region were introduced by silent mutagenesis ...
-
bioRxiv - Molecular Biology 2021Quote: ... Thermal stability at a constant 37°C was measured by a thermal shift assay using a Mx3000p real-time PCR instrument (Agilent technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... The R149W mutation in YME1L1 was introduced by PCR-based site-directed mutagenesis using the Pfu Turbo DNA polymerase (Stratagene). The Tim22 mutant and other overexpression constructs used in this study are described in detail in an earlier report (Kumar et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1.2μL each of forward and reverse primer along with 0.6μL of PCR water and 5μL Brilliant Sybr Green III qPCR master mix (Agilent Technologies; Cat# 600882). qPCR was carried out at CFX96 Touch System (Bio-Rad ...
-
bioRxiv - Plant Biology 2020Quote: Quantitative RT-PCR quantification was conducted using the standard curve method as described in the Methods and Applications Guide from Agilent Technologies ...
-
bioRxiv - Immunology 2021Quote: ... were performed with PerfeCTa SYBR green SuperMix (Quanta BioScience) using fast two-step cycling performed in a Mx3005P real time PCR machine (Stratagene) and included an initial 2 min enzyme activation step at 95°C ...
-
bioRxiv - Plant Biology 2020Quote: ... except approximately 10 seedlings were used per RNA sample and analysis was performed using an MXPro 3005 real time PCR system (Agilent) with 5x HOT FIREPol EvaGreen qPCR mastermix (Solis Biodyne) ...