Labshake search
Citations for Agilent :
1051 - 1100 of 5067 citations for 6 Methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... D614G and other SARS-CoV-2 Spike single mutations were generated using the QuickChange II XL site-directed mutagenesis protocol (Stratagene) and the pCG1-SARS-CoV-2-S plasmid kindly provided by Stefan Pöhlmann ...
-
bioRxiv - Systems Biology 2021Quote: ... The relative secreted expression of ARTN was determined by western blotting of culture supernatants using the rabbit antibody HPRK3140989 from the Human Protein Atlas and an HRP-conjugated swine anti-rabbit antibody (p039901-2, Dako) combined with Immobilon Western Chemiluminescent HRP Substrate (Millipore) ...
-
bioRxiv - Systems Biology 2021Quote: ... rabbit anti-THBS4 (antibody HPRK2400008 kindly provided from the Human Protein Atlas) as primary antibody and a HRP-conjugated swine anti-rabbit antibody (p039901-2, Dako) combined with TMB substrate (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Mutant SARS-CoV-2 expression plasmids were generated by site-directed mutagenesis using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent). Unless otherwise stated all SARS-CoV-2 spike expression plasmids were based on the Wuhan-hu-1 reference sequence 41 ...
-
bioRxiv - Systems Biology 2021Quote: ... The staining was performed according to the manufacturer’s procedure with EnVision G|2 Doublestain System Rabbit/Mouse (DAB+/Permanent Red) kit (Dako/Agilent K5361) on the Dako Autostainer ...
-
bioRxiv - Cell Biology 2021Quote: RNAi-resistant EGFP-ORP5A and EGFP-ORP5B were generated by introducing 4 silent point mutations in the region targeted by the 2 siRNA oligos (#10 and #11) by site-directed mutagenesis (Quickchange II-XL, Stratagene) and the following primers:
-
bioRxiv - Biochemistry 2020Quote: ... Radioactivity was detected using an in-line Lablogic Radiodetector and the analysis was calibrated using a co-injected 2-aminobenzamide-labeled dextran ladder (ProZyme/Agilent) detected on a Dionex fluorescence detector.
-
bioRxiv - Plant Biology 2021Quote: ... The SEGS-2 ATG mutant (pNSB2110) was created in S2-1.5b (pNSB1869) using the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies) and the primers ...
-
bioRxiv - Plant Biology 2021Quote: ... pGEX6P1:SYT1C2B (residues G374-end) and pGEX6P1:SYT1-SMPC2A (residues N34-E397) were transformed into Rosetta 2 (DE3) pLysS cells (Stratagene) for protein expression using standard protocols ...
-
bioRxiv - Microbiology 2021Quote: ... 2□μl of each sample was used to assess RNA quality using Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA), and the RNA integration numbers (RIN ...
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding the single-mutation and the combination of mutations found in SARS-CoV-2 variants were generated by Quikchange II XL site-directed mutagenesis kit (Agilent). Recombinant Indiana vesicular stomatitis virus (VSV ...
-
bioRxiv - Microbiology 2020Quote: ... Equal number of live cells was seeded at 2*105 cells per well in XF96 V3 PS plates (Seahorse Bioscience) precoated with 0.5 mg/ml Corning® Cell-Tack™ Cell and Tissue Adhesive (Corning ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were then washed twice with TBS-T followed by incubation for 1 h at room temperature in immunoreaction enhancer solution 2 (Can Get Signal; TOYOBO) with peroxidase-conjugated antibody against rabbit IgG (Dako) as the secondary antibody ...
-
bioRxiv - Cell Biology 2021Quote: ... Cellular oxygen consumption was assessed in basal condition (prior to any addition) and after addition of oligomycin (2 μM; Agilent) Carbonyl cyanide-4 (trifluoromethoxy ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.2% Triton X-100 and incubation with appropriate secondary antibody for 2 hours at room temperature in blocking buffer before washing and mounting in fluorescent mounting medium (DAKO). Images were acquired using a Leica SP8 confocal microscope.
-
bioRxiv - Microbiology 2022Quote: ... ORF6 mutations were introduced into the pLVX-StrepII-SARS-CoV-2-ORF6-IRES-Puro and pLVX-EF1α-SARS-CoV-2-ORF6-2xStrep-IRES-Puro plasmids using the QuickChange II-XL site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions using SDM primers listed below ...
-
bioRxiv - Biophysics 2022Quote: ... was pre-equilibrated with 10 mM pH 7 sodium phosphates with 150 mM NaCl on an Infinity 2 1260 HPLC system (Agilent) with an inline degasser ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Samples were filtered through Agilent Captiva syringe filters in to deactivated glass inserts (0.2 mL) placed inside amber glass vials (2 mL; Agilent Technologies). LC separations were carried out using a 1200 series LC system (Agilent Technologies) ...
-
bioRxiv - Microbiology 2022Quote: ... Residual CP and its metabolite 3,5,6-trichloro-2-pyridino (TCP) was quantified using a reverse-phase C18 column (ZORBAX Eclipse Plus, Agilent Technologies, USA) fitted with Agilent Technologies 1260 Infinity HPLC system equipped with a binary pump ...
-
bioRxiv - Biochemistry 2022Quote: ... CaCl2 was added to a final concentration of 2 mM and the supernatant was added to a disposable column containing 400 μL calmodulin resin (Agilent) pre-equilibrated with E buffer and 2 mM CaCl2 ...
-
bioRxiv - Microbiology 2022Quote: ... or SARS-CoV-2 nucleocapsid (EY-2A, a kind gift from Prof Alain Townsend) primary antibodies and appropriate HRP-conjugated secondary antibodies (DAKO). Chemiluminescence substrate (West Dura ...
-
bioRxiv - Microbiology 2020Quote: ... DNA removal was confirmed by PCR using primers OL398 and OL399 (Table 2) and RNA quality was assessed using an Agilent 2100 Bioanalyzer system with corresponding RNA 6000 Nano kit (Agilent) to confirm RNA integrity (RIN) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The resulting DNA fragments were cloned in frame with the FLAG tag using the oligonucleotides that are indicated in Supplementary file 2 into the pESC-URA vector (Agilent), in which the GAL10 and GAL1 promoters were replaced with the Cup1 promoter ...
-
bioRxiv - Immunology 2022Quote: ... viral protein in the virus-infected cells was detected by ELISA assay using anti-SARS-CoV-2 nucleocapsid mAb (40143-R001, SinoBiological) and HRP-conjugated goat anti-rabbit pAb (P0448, Dako). After 10 min incubation with TMB substrate ...
-
bioRxiv - Immunology 2022Quote: ... The negative control used was the Rabbit FLEX Universal Negative Control (cat. no. IR60066-2, Agilent, Santa Clara, CA, USA). Images were scanned using the Brightfield setting of the Vectra Polaris Multispectral Imaging System.
-
bioRxiv - Genomics 2022Quote: ... Arrays were read using an Agilent scanner at 2 μm resolution and the signal segmentation was done using the feature extraction software (Agilent). The data was normalized without background subtraction using the global Lowess method (74).
-
bioRxiv - Neuroscience 2022Quote: ... Then 25 μl of the supernatant was transferred into a 2 ml sample vial containing a 250 μl deactivated glass insert (5181-8872, Agilent). 40 μl of N-Methyl-N- (trimethylsilyl)trifluoroacetamide (MSTFA ...
-
bioRxiv - Cell Biology 2022Quote: ... yeast cells were preinoculated in selective medium and the next day an OD600 of 0.01 was inoculated in YNB medium and growth was monitored every 2 h in spectrophotometer (Cary 60 UV-Vis, Agilent). Yeast cells were transformed using a standard lithium acetate transformation protocol (Gietz and Woods ...
-
Loss of p32 triggers energy deficiency and impairs goblet cell differentiation in ulcerative colitisbioRxiv - Molecular Biology 2020Quote: ... OCR and ECAR was determined in standard Seahorse medium on day three after seeding before and after injection of 2 µM oligomycin on a XF24 analyzer (Agilent) according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: 100 μL of purified recombinant protein (at approximately 2 mg/mL) were loaded onto a sizeexclusion chromatography column (PL1580-3301, Agilent) in the phosphate buffer (20 mM Tris ...
-
bioRxiv - Microbiology 2020Quote: ... A series of alanine mutants were introduced into the SARS-CoV-2 spike protein using the QuickChange mutagenesis kit or the QuickChange multi-mutagenesis kit (Agilent). The primers for mutagenesis were designed on Agilent’s website (https://www.agilent.com/store/primerDesignProgram.jsp) ...
-
bioRxiv - Microbiology 2021Quote: ... D950N) were prepared from wild-type SARS-CoV-2 spike using the QuickChange Lighting Multi Site-directed Mutagenesis kit (Agilent). Additional RBD mutations were introduced into the Delta spike also using the QuickChange Lighting Multi Site-directed Mutagenesis kit (Agilent) ...
-
bioRxiv - Immunology 2021Quote: ... The size of the amplicon was confirmed by analyzing 2 μl of PCR products using the Agilent D5000 ScreenTape System (Agilent D5000 ScreenTape ...
-
bioRxiv - Biochemistry 2021Quote: About 2 µg of obtained total RNA was immediately used for cDNA formation using AccuScript High Fidelity cDNA Synthesis Kit (Agilent). RT-qPCR was performed in a 96-well plate on a CFX96 qPCR system (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... Supernatants were transferred into 2 mL LC/MS glass vials for the LC-MS/MS analysis by using an UHPLC system (Agilent Technologies 1290 with a UPLC BEH Amide column ...
-
bioRxiv - Immunology 2021Quote: ... Epitope retrieval was performed at 97C for 10 min with the Dako Target Retrieval Solution pH 9 (Agilent, S236784-2) on a Lab Vision PT Module (Thermo Fisher Scientific).
-
bioRxiv - Genomics 2021Quote: ... the initial concentrations of purified SARS-CoV-2 and the universal human reference RNA (UHRR, Agilent Technologies, product number 740000) were determined by ddPCR as described above ...
-
bioRxiv - Cell Biology 2021Quote: ... The jordan and shaker-2 non-synonymous substitutions were separately introduced into pFastbac1 M15-2IQ-EGFP-FLAG by site-directed mutagenesis (QuikChange II, Agilent) and verified by Sanger sequencing ...
-
bioRxiv - Cell Biology 2022Quote: ... cells in a concentration of 2×105 cells/well were transferred into an 8-well plate (Agilent Seahorse XFp miniplate), which was previously coated overnight with poly-L-lysine (Santa Cruz Biotechnology ...
-
bioRxiv - Immunology 2022Quote: ... 50 µL of Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 2% FBS was added to each well of a 96-well E-plate (Agilent) to establish the background reading ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Isolated genomic DNA was sheared to a mean size distribution of 20 kb using a Diagenode Megaruptor 2 (Denville, New Jersey, USA) and fragment size was confirmed using a Fragment Analyzer (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were then washed in PBS/0.05% Tween 20 and incubated with rabbit anti human VWF (A008229-2, DAKO/Agilent tech) 1/500 or rabbit IgG isotype control (AB-105-C ...
-
bioRxiv - Microbiology 2022Quote: The tandem mass spectrometer was hyphenated to a liquid chromatography set-up comprising 2 binary pumps (1290 series, Agilent technologies). For each experiment ...
-
bioRxiv - Molecular Biology 2022Quote: ... live cell imaging lines were generated using a U-2 OS cell line harboring a Flp-In site and stably expressing a ponasterone A inducible system (Agilent), a gift from Robert Singer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μl of each purified final library was run on an Agilent TapeStation HS D1000 ScreenTape (Agilent Technologies, 5067-5584). The libraries were quantified using the Quant-iT 1X dsDNA HS kit (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... Peptides were desalted as previously described (32) using an OT-2 liquid handling robot (Opentrons Labworks Inc.) mounted with Omix C18 pipette tips (A5700310K; Agilent). Desalted peptides were dried and stored at −80 °C prior to re-suspension in 3.0 % (v/v ...
-
bioRxiv - Neuroscience 2022Quote: Adeno-associated viral (AAV) vector serotype 2 was prepared using an AAV Helper-Free system (Agilent Technologies, Santa Clara, CA) as described previously (Kato et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the integrity and size distribution of the RNA was assessed using mRNA Nano series 2 assay (G2938, Agilent Technologies).
-
bioRxiv - Plant Biology 2024Quote: ... Peptides were desalted as previously described (60) using an OT-2 liquid handling robot (Opentrons Labworks Inc.) mounted with Omix C18 pipette tips (A5700310K; Agilent). Desalted peptides were dried and stored at - 80°C prior to re-suspension in 3.0% (v/v ...
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...