Labshake search
Citations for Agilent :
851 - 900 of 5067 citations for 6 Methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... Bound Fc chimera was detected by incubation with anti-Human IgG HRP (Agilent Dako P021402-2) diluted 1:10000 in 1% BSA/PBS for 2 h ...
-
bioRxiv - Biochemistry 2024Quote: ... Bound Fc chimera was detected by incubation with anti-Human IgG HRP (Agilent Dako P021402-2) diluted 1:10000 in 1% BSA/PBS for 2 h ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and incubated at 30°C for 48 hours in a microplate reader (BioTek Epoch 2, Agilent). Optical density at 600 nm (OD600 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Library quality was confirmed by Agilent 2200 TapeStation nucleic acids system (Agilent) using the Agilent High Sensitivity D1000 DS DNA kit ...
-
bioRxiv - Molecular Biology 2020Quote: ... Library quality was confirmed by Agilent 2200 TapeStation nucleic acid system (Agilent) using the Agilent High Sensitivity D1000 DS DNA kit ...
-
bioRxiv - Biochemistry 2023Quote: ... Medronic acid was purchased from Agilent Technologies (Santa Clara).
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were acidified with 1% formic acid (FA) and purified using OMIX C18 Mini-Bed tips (Agilent) prior to LC-MS/MS analysis.
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Molecular Biology 2021Quote: ... at 4°C overnight diluted 1:200 in antibody diluent (#S3022, Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sections were incubated at 4°C with anti-VWF (1:200, Dako) and anti-α-smooth muscle actin (1:100 ...
-
bioRxiv - Neuroscience 2024Quote: ... PSCs were then labeled with a S100 rabbit antibody (1:4, DAKO) for 2 h at RT ...
-
bioRxiv - Genomics 2022Quote: ... The bisulfite-converted library was PCR amplified and indexed using the SureSelect XT Mouse Methyl-Seq Kit (Agilent, #G9651A). Prepared libraries were run on an Illumina sequencing platform using a NextSeq High 150 bp paired-end mode.
-
bioRxiv - Immunology 2024Quote: ... 15 mM acetic acid and 2.5 µM medronic acid (5191–4506, Agilent Technologies, Santa Clara, CA, USA). The LC gradient was ...
-
bioRxiv - Microbiology 2021Quote: ... All other synthetic or expressed peptide substrates were purified and analyzed at small scale utilizing analytical-scale reverse-phase HPLC on an Agilent 1100 series HPLC system (Santa Clara, CA) employing an Eclipse Plus C18 column (5 μm, 4 × 150 mm) (Agilent) at a flow rate of 1 mL/min ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were lifted and seeded at 2×104 cells/well in XFe96 Cell Culture Microplate (Agilent Technologies) in 80 μl of fresh medium ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue sections were stained with 3,3’-diaminobenzidine solution (DAB; Liquid DAB+ Substrate Chromogen System, K346889-2, Dako), counterstained with hematoxylin ...
-
bioRxiv - Immunology 2021Quote: ... followed by EnVision FLEX DAB+ Chromogen in Substrate buffer (Agilent; anti-SARS-CoV-2, -CD8, -CD45R, -Iba1) for 10 min at RT or the DAB-Map-Kit (Ventana ...
-
bioRxiv - Microbiology 2020Quote: ... Optical densities were recorded at 600 nm every hour in Epoch 2 Microplate Reader (Biotek, Agilent Technologies).
-
bioRxiv - Cancer Biology 2021Quote: ... The primary antibodies and dilutions (dilution in DAKO REAL antibody diluent, S202230-2, DAKO, Carpinteria, CA, USA) used to study ALT were as follows ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides were rinsed in distilled water followed by treatment with EnVision FLEX Hematoxylin (Agilent DAKO, K800821-2). Slides were dried completely after rinsing in tap water and then dehydrated using xylene ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides were rinsed in distilled water followed by treatment with EnVision FLEX Hematoxylin (Agilent DAKO, K800821-2). Slides were dried completely after rinsing in tap water and then dehydrated using xylene ...
-
bioRxiv - Biophysics 2020Quote: Samples were thawed and injected onto a cooled (2 °C) HPLC System (Agilent Infinity 1260, Agilent Technologies) equipped with a home packed pepsin column (IDEX guard column with an internal volume of 60 µL ...
-
bioRxiv - Biophysics 2020Quote: Samples were thawed and injected onto a cooled (2 °C) HPLC System (Agilent Infinity 1260, Agilent Technologies) equipped with a home packed pepsin column (IDEX guard column with an internal volume of 60 µL ...
-
bioRxiv - Cancer Biology 2022Quote: ... mRNA expression data from fresh tumor tissue run by 44K Agilent Cy3/Cy5 2-color microarrays (Agilent) were available ...
-
bioRxiv - Immunology 2021Quote: ... Endogenous peroxidase was blocked by hydrogen peroxide prior to incubation with αCD3 (polyclonal rabbit, Agilent #IR50361-2) followed by the EnVision+ System-HRP Labelled Polymer Anti-Rabbit (Agilent) ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 Spike mutations were introduced using the QuikChange II XL site-directed mutagenesis protocol (Stratagene). The presence of the desired mutations was determined by automated DNA sequencing ...
-
bioRxiv - Neuroscience 2021Quote: AAV1/2 viruses were produced by large-scale triple CaPO4 transfection of HEK293-AAV cells (#240073, Stratagene) as described previously (Van Loo et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... The slides were developed by adding AEC+ High Sensitivity Substrate Chromogen Ready to use (Dako K346111-2). Antibodies used for IHC staining of EZH2 and UBE2L6 in patients’ samples can be found in Table S3 ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were plated at a density of 2×104 cells per well in a seahorse XF96 (Agilent) cell culture microplates and cultured overnight at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 150 µL respective assay medium containing 2 nM Seahorse XF Plasma Membrane Permeabilizer (Agilent 102504-100) was added after the second wash ...
-
bioRxiv - Microbiology 2021Quote: ... cuticular extracts (2 µL) or headspace samples were injected manually into a 7890A GC System (Agilent Technologies) with a DB-Wax capillary column (30 m length ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and slides were incubated with Dako Serum Free Protein Block (#X090930-2, Agilent, Santa Clara, CA, USA) at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... Cell nuclei were stained with DAPI and slides were mounted with DAKO mounting medium (Agilent S302380-2). Images were acquired using Leica TCS SP8 confocal microscope (Leica Microsystems) ...
-
bioRxiv - Neuroscience 2021Quote: ... The ICP-MS apparatus was calibrated using multielement calibration standard 2A in 2% HNO3 (Agilent Technologies, USA) containing Ag ...
-
bioRxiv - Immunology 2022Quote: ... 2 μm paraffin-embedded kidney sections were stained with anti-CD3 (polyclonal, Agilent Technologies, Santa Clara, CA) or anti-CD8 (D4W2Z ...
-
bioRxiv - Neuroscience 2022Quote: ... transferred onto glass slides and mounted for visualization with DAKO anti-fading mounting medium (#S302380-2 Agilent).
-
bioRxiv - Synthetic Biology 2022Quote: The synthetic oligo pool library used for the secondary screening assay (Round 2) was obtained from Agilent. The oligonucleotides were designed to conform to the same template binding and assembly overlapping sequences as described above for the Round 1 NNK primers ...
-
bioRxiv - Physiology 2023Quote: ... BMSC purified with MACS were seeded at 2 × 105 cells/cm2 into XF96 tissue culture microplates (Agilent) at 24 hours prior to experiments ...
-
bioRxiv - Physiology 2022Quote: ... and a Masson’s Trichrome Stain Kit to identify collagen fibers and fibrin (AR17311-2, Artisan, Dako, Agilent). Stainings were performed in a Dako Autostainer Plus (Dako ...
-
bioRxiv - Physiology 2022Quote: ... and a Masson’s Trichrome Stain Kit to identify collagen fibers and fibrin (AR17311-2, Artisan, Dako, Agilent). Stainings were performed in a Dako Autostainer Plus (Dako ...
-
bioRxiv - Cancer Biology 2022Quote: ... rehydrated and submitted to heat-induced epitope retrieval at pH9 (Dako target retrieval solution, #S236784-2, Agilent) and 97°C for 10 min in a Lab Vision PT module (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antibody detection was performed using EnVision FLEX/HRP (GV80011-2, Dako, Agilent Technologies, Santa Clara, CA, USA). IHC pictures were taken with a Pannoramic 250 Flash II Digital Slide Scanner and analyzed with the Pannoramic Viewer (3DHISTECH Ltd. ...
-
Adolescent parvalbumin expression in the left orbitofrontal cortex shapes sociability in female micebioRxiv - Animal Behavior and Cognition 2023Quote: ... for 2 hours at RT before mounting the slices in a transparent mounting medium (DAKO, cat#S3023). We manually and blindly counted the number of WFA+ neurons within 0.5 × 0.5mm2 ROIs in three representative coronal sections covering OFC.
-
bioRxiv - Biophysics 2023Quote: The samples were shortly centrifuged after thawing and injected onto a cooled (2°C) HPLC System (Agilent Infinity 1260 ...