Labshake search
Citations for Agilent :
1101 - 1150 of 5067 citations for 6 Methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... Peptides were desalted as previously described (60) using an OT-2 liquid handling robot (Opentrons Labworks Inc.) mounted with Omix C18 pipette tips (A5700310K; Agilent). Desalted peptides were dried and stored at - 80°C prior to re-suspension in 3.0% (v/v ...
-
bioRxiv - Microbiology 2023Quote: ... Culture plates were incubated at 37°C for 22 hrs and kept anaerobic during the OD600 measurement in a Synergy 2 Plate Reader (Biotek Agilent Technologies Deutschland GmbH ...
-
bioRxiv - Cancer Biology 2023Quote: ... was performed using the Exome Cancer Test v2.0 (EXaCT-2) assay that was developed with Agilent based on SureSelect Human All Exon V6 (Agilent Technologies) (manuscript in preparation) ...
-
bioRxiv - Cancer Biology 2024Quote: Paraffin-embedded human HCC samples were cut into 3.5-µm thick tissue sections and processed for immunohistochemistry with the EnVision FLEX kit material (K800021-2, Agilent Dako) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Molecular Biology 2023Quote: ... On day 2 the XF Real-Time ATP Rate Assay Kit (Cat. No. 103592-100, Agilent Technologies, Cedar Creek, TX) was run following the manufacturer’s protocol using the Seahorse XF96 Analyzer as described above.
-
bioRxiv - Cell Biology 2022Quote: ... cells in a concentration of 2×105 cells/well were transferred into an 8-well plate (Agilent Seahorse XFp miniplate), which was previously coated overnight with poly-L-lysine (Santa Cruz Biotechnology ...
-
bioRxiv - Immunology 2022Quote: ... 50 µL of Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 2% FBS was added to each well of a 96-well E-plate (Agilent) to establish the background reading ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Isolated genomic DNA was sheared to a mean size distribution of 20 kb using a Diagenode Megaruptor 2 (Denville, New Jersey, USA) and fragment size was confirmed using a Fragment Analyzer (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were then washed in PBS/0.05% Tween 20 and incubated with rabbit anti human VWF (A008229-2, DAKO/Agilent tech) 1/500 or rabbit IgG isotype control (AB-105-C ...
-
bioRxiv - Microbiology 2022Quote: The tandem mass spectrometer was hyphenated to a liquid chromatography set-up comprising 2 binary pumps (1290 series, Agilent technologies). For each experiment ...
-
bioRxiv - Molecular Biology 2022Quote: ... live cell imaging lines were generated using a U-2 OS cell line harboring a Flp-In site and stably expressing a ponasterone A inducible system (Agilent), a gift from Robert Singer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μl of each purified final library was run on an Agilent TapeStation HS D1000 ScreenTape (Agilent Technologies, 5067-5584). The libraries were quantified using the Quant-iT 1X dsDNA HS kit (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... Peptides were desalted as previously described (32) using an OT-2 liquid handling robot (Opentrons Labworks Inc.) mounted with Omix C18 pipette tips (A5700310K; Agilent). Desalted peptides were dried and stored at −80 °C prior to re-suspension in 3.0 % (v/v ...
-
bioRxiv - Microbiology 2023Quote: ... were prepared and stained with hematoxylin eosin (HE) for histological examination or subjected to immunohistological staining to detect SARS-CoV-2 antigen (performed in an autostainer; Agilent), using the horseradish peroxidase (HRP ...
-
bioRxiv - Plant Biology 2023Quote: ... and 2 µg DNase-treated RNA was reverse transcribed using a cDNA Synthesis Kit (Agilent Technologies, Santa Clara, CA, USA), following the respective manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 100 µl of purified proteins at ∼2 mg/ml concentration were injected onto a Superdex 200 Increase 10/300 column (Cytiva) on an HPLC (Agilent) connected to miniDAWN TREOS and Optilab T-rEX detectors (Wyatt Technology) ...
-
bioRxiv - Genomics 2024Quote: ... The high-molecular weight DNA sample was then sheared to a mean size of 20 kb with a Diagenode Megaruptor 2 (Denville, New Jersey, USA) and the subsequent size distribution was assessed with an Agilent Fragment Analyzer (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... An aliquot of 200 µL from each sample was separated and diluted to 2 mL of 2% v/v HNO3 and analysed for Sr content via inductively coupled plasma mass spectrometry (ICP-MS; Agilent 8800 ICP-QQQ ...
-
bioRxiv - Plant Biology 2024Quote: ... acetonitrile and 2 µl was injected for the analysis with LC/MS (6520 Accurate-Mass Q-TOF connected to Agilent 1100 Series HPLC ...
-
bioRxiv - Immunology 2024Quote: ... Immunodetection was carried out with the indicated antibodies (Extended Data Table 2) and bound antibodies were visualized with peroxidase-conjugated affinity-purified donkey anti-mouse or anti-rabbit IgG (Dako), or HRP-linked anti-rat IgG (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2024Quote: Bacterial growth in LB was monitored over time using absorbance measurements at 600 nm on the BioTek Epoch 2 (Agilent). An overnight pre-inoculum in LB was adjusted to OD600 nm 0.01 in LB ...
-
bioRxiv - Cell Biology 2024Quote: ... SC/KD-miRNA-transduced MIN6 cells were cultured in 2 mM glucose and treated with a total RNA isolation mini kit (Agilent) and 1st strand synthesis kit (Origine) ...
-
bioRxiv - Bioengineering 2024Quote: ... The final co-cultures were then incubated at 37°C in an automated spectrophotometer (Biotek Synergy 2, Agilent Technologies, USA) for 48 hours ...
-
bioRxiv - Microbiology 2024Quote: ... Infection curve analysis was conducted by combining 107 CFU/ml of the clinical isolate selected and 108 PFU/ml of the phage selected in 200 µl of LB broth in a 96 well microplate and incubating for 24 h at 37°C in an Biotek Epoch 2 (Agilent). Productive infection was assumed to have taken place when the OD was significantly lower than the control in the exponential phase.
-
bioRxiv - Microbiology 2024Quote: ... tissues were incubated with primary antibodies overnight (Iba1 (019-19741, FUJIFILM Wako Pure Chemical Corporation) or S100b (GA50461-2, Agilent)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Antigen retrieval was performed at 95-98°C for 30 min using 1X of Target Retrieval Solution pH9 (S236784-2, Agilent). The tissue slides were cooled down for 20 min at RT ...
-
bioRxiv - Biophysics 2020Quote: ... Calibration curves of individual and mixed amino acids were prepared using either 250 pmol stocks of corresponding individual amino acids or a 250 pmol amino acid standard mix (Agilent #5061-3331). Quantification was performed using calibration curves of the respective amino acid standards.
-
bioRxiv - Biophysics 2021Quote: ... (buffer A: 0.1% trifluoro-acetic acid in water, buffer B 100% acetonitrile with 0.1% trifluoro-acetic acid; Agilent Zorbax 300SB-C18 column). Collected protein fractions were lyophilized and stored at −20 °C.
-
bioRxiv - Cancer Biology 2021Quote: ... Antibodies were directed against: glial fibrillary acid protein (GFAP; Z0334, rabbit polyclonal, 1:1000 dilution, Dako Agilent, Santa Clara, CA, USA), epithelial membrane antigen (EMA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Antibodies were directed against: glial fibrillary acid protein (GFAP; Z0334, rabbit polyclonal, 1:1000 dilution, Dako Agilent, Santa Clara, CA, USA), epithelial membrane antigen (EMA ...
-
bioRxiv - Molecular Biology 2024Quote: ... After irradiation the sample was combined with 10 µl of formic acid 1 % and 10 µl analyzed by LC-MS using an Ultimate 1100 HPLC system (Agilent Technologies) connected to an Amazon Speed ETD ion-trap mass spectrometer (Bruker Daltonics) ...
-
bioRxiv - Genetics 2020Quote: ... The concentration of amino acids was determined by Agilent 1260 HPLC system ...
-
bioRxiv - Biochemistry 2023Quote: ... and 0.01% medronic acid (v/v, 5191-4506, Agilent). For the re-equilibration gradient ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.01% medronic acid (v/v, 5191-4506, Agilent). For the re-equilibration gradient ...
-
bioRxiv - Cancer Biology 2023Quote: ... in 3 cycles for 3 hours using the Seahorse XFe24 analyzer system (Agilent Technologies). Inhibitors and substrates were used at the following concentrations ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm column (Agilent), column temperature 50 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... The HPLC profile of tannic acid and gallic acid at both pH’s was obtained using an Infinity II HPLC system (Agilent Technologies, Santa Clara, CA) and an Agilent 5 prep-C18 column (50×21.2 mm ...
-
bioRxiv - Bioengineering 2023Quote: ... The optical purity of L-lactic acid and D-lactic acid were measured via a HPLC system (Agilent 1260 series, Hewlett-Packard, USA) equipped with a SCAS Sumichiral OA-5000 column (150 × 4.6 mm ...
-
bioRxiv - Biophysics 2021Quote: ... 7.8 mm ID x 300 mm column equilibrated in GF150 buffer (25 mM HEPES-KOH, 150 mM KCl, 2 mM MgCl2) plumbed into an HPLC (Agilent 1100). Molecular masses were analyzed by an inline SEC-MALs system (Wyatt Technology ...
-
bioRxiv - Microbiology 2020Quote: ... The SARS-CoV-2 RBD constructs carrying point mutation were generated by following the standard protocol from QuikChange® II XL Kit (Agilent). The cloned genes were sequenced to confirm that no errors had accumulated during the PCR process ...
-
bioRxiv - Cell Biology 2020Quote: ... The cell viability was assessed by measuring the absorbance at 570 nm wavelength using Epoch 2 microplate spectrophotometer (Agilent technologies. USA).
-
bioRxiv - Developmental Biology 2021Quote: ... The single layer supernatant was pipetted into separate 2 mL screw cap amber-glass autosampler vials (Agilent Technologies, Cheadle, United Kingdom); being careful not to break up the solid pellet at the bottom of the tube ...
-
bioRxiv - Neuroscience 2021Quote: ... TUJ1 (Covance) and CMTM5 (custom made by Pineda, Berlin, Germany Table 2) antibodies were diluted in antibody diluent (DAKO, Hamburg, Germany) and incubated for 48 hours at 4°C in a dark ...
-
bioRxiv - Neuroscience 2021Quote: Purpose built rodent specific coils (circular coil 8mm in diameter and height-see [2]) controlled by an arbitrary waveform generator (Agilent 335141B) connected to a bipolar power supply (Kepco BOP 100-4M ...
-
bioRxiv - Microbiology 2021Quote: ... The RNA was then cross-linked to positively charged membranes using a UV-crosslinker (Stratagene UV Stratalinker 2400, 2×240 mJoules) and stained with methylene blue (SERVA ...
-
bioRxiv - Systems Biology 2021Quote: ... The staining was performed according to the manufacturer’s procedure with EnVision G|2 Doublestain System Rabbit/Mouse (DAB+/Permanent Red) kit (Dako/Agilent K5361) on the Dako Autostainer ...
-
bioRxiv - Biochemistry 2020Quote: ... Radioactivity was detected using an in-line Lablogic Radiodetector and the analysis was calibrated using a co-injected 2-aminobenzamide-labeled dextran ladder (ProZyme/Agilent) detected on a Dionex fluorescence detector.
-
bioRxiv - Biochemistry 2021Quote: Plasmids encoding AlgE7 variants (Table 2) were constructed based on wild type AlgE7 (plasmid pBG27) (12) using the QuikChange™ Site-directed Mutagenesis Kit (Stratagene/Agilent) or Q5 site directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were further diluted with ultrapure water to a final concentration of 2% HNO3 and subjected to ICP-MS on Agilent 7700 ICP-MS (Agilent Technologies). ICP-MS runs were calibrated with high-purity iron standard solution (Sigma-Aldrich ...