Labshake search
Citations for Agilent :
51 - 100 of 1407 citations for ssc mir 15a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Importin α/β Promote Kif18B Microtubule Association to Spatially Control Microtubule DestabilizationbioRxiv - Cell Biology 2022Quote: ... 639KKRRRPSALEADSPMAPKR657 were mutated sequentially to alanine with the NLS1a and NLS1b primer sets listed in Table S8 using the QuikChange site-directed mutagenesis system (Agilent, San Diego, CA) to create pET24b(+)-YPet-Kif18B(605-828)-NLS1 ...
-
bioRxiv - Physiology 2020Quote: ... q-RT-PCR was performed using Brilliant III SYBR Green QPCR Master Mix (Agilent) on the StepOne+ Real-Time PCR system (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1X Brilliant II qRT-PCR mastermix with 1 uL RT/RNase block (Agilent 600825), and 200 nM forward and reverse primer were used ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative RT-PCR was performed using the Mx3000P QPCR System (Agilent Technologies, Lexington, MA) with incubation parameters of 2 min at 50°C ...
-
bioRxiv - Immunology 2023Quote: RT-PCR product was QC’ed using the DNA high sensitivity Bioanalyzer Chip (Agilent Technologies). Sample preparation for Illumina deep sequencing was done using the KAPA HyperPrep Kit ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was reversed transcribed with MARS-seq barcoded RT primers in a 10 μl volume with the Affinity Script kit (Agilent). Reverse transcription was analyzed by qRT-PCR and samples with a similar CT were pooled (up to eight samples per pool) ...
-
bioRxiv - Cell Biology 2023Quote: ... Mutagenesis was performed by PCR using mutated primers and a site-directed mutagenesis kit (Stratagene).
-
bioRxiv - Plant Biology 2019Quote: ... was performed by real-time RT-PCR (qRT-PCR) using the BRILLIANT II SYBR® GREEN QPCR Master Mix and the Mx3000P qPCR system (Stratagene, Agilent Technologies Inc. ...
-
bioRxiv - Plant Biology 2019Quote: ... was performed by real-time RT-PCR (qRT-PCR) using the BRILLIANT II SYBR® GREEN QPCR Master Mix and the Mx3000P qPCR system (Stratagene, Agilent Technologies Inc. ...
-
bioRxiv - Genetics 2023Quote: ... Rev: TACTTCCAGCCAACCTCGTGAG) were used to perform Quantitative RT-PCR using the Brilliant II SYBR Green QRT-PCR Master Mix (Agilent # 600825) with the following program ...
-
bioRxiv - Molecular Biology 2021Quote: RT-PCR was performed in a Stratagene™ Mx3005P qPCR instrument (Agilent Technologies, Waldbronn, Germany) using 10 μl QuantiTec SYBR Green PCR mix (Qiagen) ...
-
bioRxiv - Biochemistry 2019Quote: DSF was performed in a 96-well plate using an Mx3005p RT-PCR machine (Stratagene). Each well (20 µl ...
-
bioRxiv - Physiology 2022Quote: ... qPCR analysis was performed using the Stratagene MX3000P RT-PCR System (Stratagene, La Jolla, CA) in a 25-μL reaction mixture ...
-
bioRxiv - Biochemistry 2020Quote: DSF was performed in a 96-well plate using an Mx3005p RT-PCR machine (Stratagene) with excitation and emission filters of 492 and 610 nm ...
-
bioRxiv - Molecular Biology 2024Quote: ... Real-time quantitative PCR (RT-qPCR) was performed using SYBR Green qPCR Master Mix (Agilent) in an ABI 7500 real-time qPCR machine (Life Technologies) ...
-
bioRxiv - Genetics 2021Quote: ... Primers were used in a high fidelity PCR reaction using Pfu DNA polymerase obtained from Agilent® ...
-
bioRxiv - Cancer Biology 2021Quote: ... and specific primers (Table 1) were performed using an AriaMX Real-time PCR system (Agilent Technologies). Relative expression of mRNAs was determined after normalization against housekeeping genes TBP ...
-
bioRxiv - Microbiology 2024Quote: ... pBRplac derivatives were mutagenized using PCR with mutagenic primers and the Pfu Turbo DNA polymerase (Agilent), followed by DpnI digestion of the template ...
-
bioRxiv - Cancer Biology 2023Quote: ... and MAC-seq PreAmp PCR primer and the quality checked on a D5000 Screentape (TapeStation, Agilent). One barcoded library was prepared per plate using TD buffer and TDE1 enzyme (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... Triplicate reactions were set up in Semi-skirted 96-Well PCR Plates (0.2 ml) with optical strip caps (Agilent). The PCR reactions were carried out in an AriaMx Real-time PCR System (Agilent) ...
-
bioRxiv - Genetics 2024Quote: ... Reactions were set up in optical PCR tubes and run on an AriaMX Real-Time qPCR cycler (Agilent, USA) with Fam and Hex filters ...
-
bioRxiv - Cell Biology 2023Quote: ... Primers were designed with QuikChange Primer Design (Agilent). To make NF-L-myc-6xHis glycosite mutants ...
-
bioRxiv - Biochemistry 2020Quote: Human ISG15 cDNA was amplified by RT-PCR from universal human reference RNA (Agilent 740000-41), adding BamHI and NotI restriction sites at the 5’ and 3’ ends respectively ...
-
bioRxiv - Physiology 2022Quote: ... Quantitative RT–PCR was performed using the Mx3000P Real-Time QPCR System (Agilent Technologies, Tokyo, Japan). Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... Primers were designed via Quikchange primer design tool (Agilent). Designed primer pairs are shown below ...
-
bioRxiv - Cancer Biology 2024Quote: ... with primers generated using either QuikChange Primer Design (Agilent) or NEBaseChanger (New England Biolabs (NEB)) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 0.4 μL of upstream and downstream primers using an Mx3000P Real-Time PCR System (Agilent, USA). Primers used for PCR were as follows ...
-
bioRxiv - Biophysics 2023Quote: ... we made handles using the same primers CD21 and CD22 in a PCR on pBlueScriptSKII SK+ (Stratagene) either in the presence of digoxigenin-11-dUTP/dTTP ...
-
bioRxiv - Pathology 2024Quote: ... 300 nM of forward and μ reverse primers (Table S5) in AriaMx Real-time PCR System (Agilent) with the following thermal conditions ...
-
bioRxiv - Cell Biology 2022Quote: Gene expression was analyzed by real time reverse transcriptase quantitative PCR (RT-qPCR) according to the Fast SYBR Green protocol with the AriaMx real-time PCR detection system (Agilent technologies, Santa Clara, CA). Primers were ordered from Invitrogen (ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: Gene expression was analyzed by real time reverse transcriptase quantitative PCR (RT-qPCR) according to the Fast SYBR Green protocol with the AriaMx real-time PCR detection system (Agilent technologies, Santa Clara, CA). Primers were ordered from Invitrogen (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2019Quote: ... Quantification of the purified RT-PCR products was also performed using an Agilent 2100 Bioanalyzer (Agilent Technologies) according to the Agilent High Sensitivity DNA kit instructions.
-
bioRxiv - Biochemistry 2019Quote: ... Plates were sealed using optically clear films and transferred to an Agilent Mx3005p RT-PCR machine (Agilent). The fluorescence intensity was measured during a temperature gradient from 25 to 95 °C at a constant rate of 0.05 °C/s ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative RT-PCR reaction targeting RdRP gene was performed in triplicate in a Mx3005P QPCR System (Agilent) using PrecisionFAST qPCR Master Mix (PFAST-LR-1 ...
-
bioRxiv - Microbiology 2021Quote: Real-time RT-PCR was performed using Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... and primers generated by QuikChange® Primer Design (Agilent Technologies). The entire C-prM-E region was sequenced (Quintara ...
-
bioRxiv - Cell Biology 2020Quote: ... using primers designed using the QuikChange Primer Design tool (Agilent). Site-directed mutagenesis primers can be found in Table 5 ...
-
bioRxiv - Microbiology 2020Quote: ... Data sets were exported from Agilent’s Chemstation software as .netCDF files and imported into MZmine 2.38 (70) ...
-
bioRxiv - Molecular Biology 2019Quote: ... a post-capture PCR amplification step was carried out using SureSelectXT ILM Indexing post-capture primers (Agilent Technologies) with 14-16 PCR amplification cycles.
-
bioRxiv - Genomics 2020Quote: The Aβ coding sequence and two flanking regions of 52bp and 72bp respectively upstream and downstream of Aβ were amplified (primers MS_01 and MS_02, Supplementary file 2) by error-prone PCR (Mutazyme II DNA polymerase, Agilent). 30 cycles of amplification and 0.01ng of initial template were used to obtain a mutagenesis rate of 16 mutations/kb ...
-
bioRxiv - Biophysics 2023Quote: ... We made both handles using primers CD21 and CD22 (Table S2) in a PCR on pBlueScriptSKII SK+ (Stratagene). This was done in the presence of 1/5 biotin-16-dUTP/dTTP or digoxigenin-11-dUTP/dTTP (two separate reactions ...
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... and a randomly selected subset of these embryos was assayed for the target locus disruption through genotyping PCR using vps13b_geno_F/R primers (see Supplementary materials Table S1) and resolving the resulting PCR products on Fragment Analyzer (Agilent).
-
bioRxiv - Immunology 2020Quote: cDNA was synthesized by using the AffinityScript One-Step RT-PCR Kit (Cat# 600559, Agilent, Santa Clara, US) using extracted RNA ...
-
bioRxiv - Cell Biology 2020Quote: ... Libraries were quantified by quantitative RT-PCR using Agilent qPCR Library Quantification Kit and a MX3005P instrument (Agilent) and relative volumes were pooled accordingly ...
-
bioRxiv - Molecular Biology 2022Quote: ... Quantitative RT-PCR and relative quantification analyses were performed with the MX3000P system (Agilent, Santa Clara, CA, USA) using SYBR Green dye chemistry ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... total RNAs were obtained and amplified by high-fidelity RT-PCR using the AccuScript Hi-Fi (Agilent Technologies) reverse transcriptase and Phusion DNA polymerase (Thermo Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... Primers (IDT) were designed using the primer design tool from Agilent. The following primer pairs were used ...
-
bioRxiv - Cell Biology 2021Quote: ... Primers were designed using the Quick Change primer design tool (Agilent) and here are the sequences ...
-
bioRxiv - Biophysics 2022Quote: ... Primers were designed with the QuickChange Primer Design Program (Agilent Technologies). Constructs were confirmed by DNA sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... All primers were designed using the QuickChange Primer Design Program (Agilent) and are listed in Supplemental Table 2 ...