Labshake search
Citations for Agilent :
351 - 400 of 1407 citations for ssc mir 15a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... The quantitative PCR (qPCR) amplification was carried out in a MX 3005 real-time PCR system (Agilent) using Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were cloned using StrataClone PCR cloning kit (product no: 240205, Agilent technologies Sweden AB, Kista) and re-amplified with M13F/M13R primers using DreamtTaq (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Quantitative PCR (5 ng cDNA/well) was performed by using QuantiNova kit on Mx3500P PCR machine (Stratagene). Gene-specific primers were used for end-point PCR (HotStarTaq Plus DNA Polymerase ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR products were ligated into pSC-A vectors using a Blunt-end PCR cloning kit (Agilent #240207). Ligated plasmids were transformed into XL-1 blue competent cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative PCR was performed with FastSYBR Mixture (CW0955L, Cwbio) on the AriaMx Real-Time PCR System (Agilent) using the primers listed in Supp ...
-
bioRxiv - Neuroscience 2022Quote: ... Amplified cDNAs for a set of random selected samples were quantified and run on a High Sensitivity Bioanalyzer chip (Agilent, cat# 5067-4626) on a 2100 Bioanalyzer (Agilent).
-
bioRxiv - Neuroscience 2024Quote: ... Optical density of each sample was read at 450 nm with a wavelength correction set to 540 nm using a BioTek Gen5 Microplate Reader and Imager Software (Agilent, Santa Clara, CA). The triplicate OD measurements for each standard and tissue sample were averaged and the BDNF concentration in pg/ml was calculated and converted to pg/mg tissue weight.
-
bioRxiv - Cancer Biology 2024Quote: ... The slides were processed as described and probed with a set of 264 antibodies against total proteins and phosphoproteins using an automated slide stainer Autolink 48 (Dako, Santa Clara, CA). Each slide was incubated with one specific primary antibody and a negative control slide was incubated with antibody diluent without any primary antibody ...
-
bioRxiv - Cancer Biology 2023Quote: ... The slides were processed as described and probed with a set of 258 antibodies against total proteins and phosphoproteins using an automated slide stainer Autolink 48 (Dako, Santa Clara, CA). Each slide was incubated with one specific primary antibody and a negative control slide was incubated with antibody diluent without any primary antibody ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR amplification was performed by the use of an MX3000P Multiplex Quantitative PCR System (Stratagene, CA, USA). Data analysis was carried out with MxPRO qPCR software (Stratagene ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The expression pattern of CYP6P9a and CYP6P9b was assessed by quantitative real time PCR (qRT-PCR) (Agilent MX3005) to assess the correlation between the presence of the 6.5kb SV and the expression pattern of these two resistance genes.
-
bioRxiv - Physiology 2020Quote: ... Real-time PCR was carried out using an AriaMx real-time PCR system (Agilent Technologies, Santa Clara, CA) to measure mRNA levels ...
-
bioRxiv - Immunology 2022Quote: ... Knockout PCR products were cloned into pSC-B-amp/kan with the StrataClone Blunt PCR Cloning Kit (Agilent) and Sanger sequenced to determine the exact deletion ...
-
bioRxiv - Genomics 2021Quote: ... the PCR was performed in triplicate per ligation reaction using the Herculase II PCR reagents (Agilent Technologies, 600677). The parallel library preparations and PCR reactions were subsequently pooled for each reaction.
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR analysis was performed with SYBR Premix Ex Taq II on AriaMx Real-time PCR system (Agilent). Specific primer sets for age-related genes and housekeeping gene were used ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative PCR was performed using PerfeCTa SYBR Green Fastmix (Quantabio) on a AriaMx Real-time PCR System (Agilent, US under the following conditions ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative PCR was performed using the Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent, 600886) on a Mx3005P Real-Time PCR System (Agilent) ...
-
bioRxiv - Cancer Biology 2024Quote: ... then long-term drug responses were recorded every 30 minutes through (RT-CES) (ACEA Biosciences; Agilent Technologies). Cell Index values (CI ...
-
Adolescent parvalbumin expression in the left orbitofrontal cortex shapes sociability in female micebioRxiv - Animal Behavior and Cognition 2023Quote: ... for 2 hours at RT before mounting the slices in a transparent mounting medium (DAKO, cat#S3023). We manually and blindly counted the number of WFA+ neurons within 0.5 × 0.5mm2 ROIs in three representative coronal sections covering OFC.
-
bioRxiv - Cell Biology 2023Quote: ... RT–qPCR reactions were performed using Brilliant III Ultra-Fast SYBR Green qPCR Master mix (Agilent Technologies) with the relevant primers (Sigma-Aldrich) ...
-
bioRxiv - Plant Biology 2023Quote: ... The RT-qPCR was carried out using Brilliant III Ultra-Fast SYBR Green qPCR kit (Agilent Technologies) on an AriaMx G8830A Real-Time qPCR System (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: RT-qPCR was performed by using the Brilliant III SYBR® Green QPCR Master Mix (Agilent #600882) or DyNAmo HS SYBR Green (Thermo Scientific #F410L ...
-
bioRxiv - Cell Biology 2019Quote: ... iv) the 4xNLS sequence was removed with the primers DPD695 and DPD696 using QuikChange Site-Directed Mutagenesis (Agilent) to generate pDD111 - Pegl-1::mCherry::PH::unc-54 3’UTR.
-
bioRxiv - Microbiology 2021Quote: ... plasmid was reacted with primer pairs designed to introduce the desired mutations using Quikchange kit (Agilent, cat# 600670). After digestion with the restriction enzyme DpnI (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... The mutants were created by the same method for site-directed mutagenesis using specific primers designed from Agilent QuickChange Primer design web tool ...
-
bioRxiv - Pathology 2021Quote: ... The promoter DNA was amplified with primers containing Nhe1 and Xho1 sites using Pfu Ultra II polymerase (Agilent) to generate the 0.7 kb truncated form in the pGL3-basic vector ...
-
bioRxiv - Microbiology 2020Quote: ... the primer pair dsbS(H235A)-F/R and a QuikChange II site-directed mutagenesis kit (Stratagene, catalog#:200518) were used ...
-
bioRxiv - Molecular Biology 2022Quote: ... Quick-change Site-Directed Mutagenesis was conducted using primers listed in Table S4 using the Quick-change (Agilent) or Q5-Site-directed mutagenesis kit (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... The DNA probes were labeled with [α-32P] dCTP by Prime-It II Random Primer Labeling Kit (Stratagene) as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA probes were labeled with 32P using the Prime-It II Random Primer Labeling Kit (Agilent Cat. #300385). The Syngap1 probe corresponds to NM_001281491 nucleotides 1361- 2002 ...
-
bioRxiv - Neuroscience 2024Quote: ... S13D mutagenesis was performed using mutagenic primers and Pfu Turbo Cx DNA polymerase (Agilent Technologies, Santa Clara, CA) (See Table S5 for mutagenic primer sequences).
-
bioRxiv - Evolutionary Biology 2019Quote: ... we preformed PCR using PFUultra II (Agilent), the primers F1 and R3 5’gaggtgggcagtcatccatc3’ ...
-
bioRxiv - Cancer Biology 2021Quote: ... and AriaMx Real-Time PCR System (Agilent). Relative gene expression was normalized to internal control genes ...
-
bioRxiv - Plant Biology 2021Quote: ... in real time PCR (Agilent Technologies, USA) detection system ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using Herculase II (Agilent) or Q5 High-fidelity DNA Polymerase (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... The AriaMX real-time PCR system (Agilent) served for thermal cycling of the duplicate samples with the recommended conditions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... qRT-PCR was performed by MX3000P(Agilent) using UltraSYBR Mixture (Low ROX ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was performed using AriaMX (Agilent) with 12.5 μl of either Power SYBR Green master mix or Taqman master mix (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... and AriaMx Real-time PCR Systems (Agilent). TBEV forward primer (5’-3’ GGGCGGTTCTTGTTCTCC) ...
-
bioRxiv - Biochemistry 2021Quote: ... For PCR mutagenesis PFU Ultra Polymerase (Stratagene) was used ...
-
bioRxiv - Cancer Biology 2023Quote: ... on AriaMx qRT-PCR system (Agilent Technologies). The following primers were used ...
-
bioRxiv - Cell Biology 2023Quote: ... A Real-Time PCR Mx3005p machine (Stratagene) was used to record fluorescence ...
-
bioRxiv - Biophysics 2023Quote: ... PCR site directed mutagenesis kit (Agilent Technologies) was used according to the instruction manual for mutagenesis PCR.
-
bioRxiv - Neuroscience 2023Quote: ... PCR products were confirmed by Tapestation (Agilent), and cleaned up with ExoSAP-IT (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... and mycoplasma testing (MycoSensor PCR assay, Agilent) was performed yearly.
-
bioRxiv - Evolutionary Biology 2020Quote: ... Purity and integrity of the RNA was assessed on the Agilent 2100 Bioanalyzer with the RNA 6000 Pico LabChip reagent set (Agilent, Palo Alto, CA, USA).
-
bioRxiv - Genomics 2021Quote: ... Libraries from all sample sets were quantified on the 2100 Bioanalyzer instrument with the Agilent DNA 7500 Kit (both Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Immunology 2020Quote: ... Purity and integrity of the RNA was assessed on the Agilent 2100 Bioanalyzer with the RNA 6000 Pico LabChip reagent set (Agilent, Palo Alto, CA, USA). The SMARTer Ultra Low Input RNA Kit for Sequencing v4 (Clontech Laboratories ...
-
bioRxiv - Physiology 2023Quote: ... in 10X magnification in non-confocal mode with DAPI filter set (ex.405/em.455nm) and FITC filter set (ex.488/em.525nm) on the automated high content screening platform (Agilent Technologies, Santa Clara, USA) (Equipex Imaginex Biomed ...
-
bioRxiv - Neuroscience 2024Quote: ... Purity and integrity of the RNA was assessed on the Agilent 2100 Bioanalyzer with the RNA 6000 Pico LabChip reagent set (Agilent, Palo Alto, CA, USA).