Labshake search
Citations for Agilent :
801 - 850 of 7234 citations for Human Low affinity immunoglobulin gamma Fc region receptor II c FCGR2C ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... of matched-PBMC DNA was fragmented using the SureSelect XT HS and XT Low Input Enzymatic Fragmentation Kit following the manufacturer’s instructions (Agilent, Santa Clara, USA, cat # 5191-4080). Molecular-barcoded libraries were constructed following the SureSelect XT HT targeted enrichment protocol for Illumina paired-end multiplexed sequencing libraries (Version A1 ...
-
bioRxiv - Genomics 2020Quote: ... A corresponding screenshot showing read visualization when using the SureSelect Human All Exon V6 kit from Agilent is presented in Figure 5 ...
-
bioRxiv - Genetics 2022Quote: ... WES was performed using the SureSelect XT Human All Exon V6 kits (Agilent, Santa Clara, CA, USA). CLC Genomics Workbench version 7.0.5 (CLCBio ...
-
bioRxiv - Genomics 2020Quote: ... III14 and IV9 in this family by using SureSelect Human All Exon Kit (Agilent, Santa Clara, CA) to capture the exome and HiSeq2000 platform (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: The exome was captured using Agilent SureSelect Human All Exon V5 kit (Agilent, Santa Clara, CA, US) and sequenced in a HiSeq instrument (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... the pre-capture libraries containing exome sequences were captured using SureSelect Human All Exon V6 kit (Agilent). DNA concentration of the enriched sequencing libraries was measured with the Qubit 3.0 fluorometer dsDNA HS Assay (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... pSPHA-EPA1(0 rep) was created by deleting the repeat region from EPA1 by QuickChange Mutagenesis (Agilent), amplifying EPA1 with OCR035 and OCR036 primers and cloning via Gibson Assembly as described above.
-
bioRxiv - Molecular Biology 2021Quote: ... The genomic region targeted by the CRISPR–Cas9 was amplified by PCR using Turbo Pfu polymerase (Agilent) and the PCR product was cloned into the pCR2.1 TOPO vector (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... Three regions of the FWA gene were amplified from the converted DNA with Pfu Turbo Cx (Agilent): Region 1 (chr4 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sections of human tumors were stained with mouse anti-human CD68 (Dako) and goat anti-human TSP-4 (AF2390 ...
-
bioRxiv - Genomics 2019Quote: ... with Low Input Quick Amp Labeling protocol (Agilent Technologies cat.# 5190-2331) and the Cy3 fluorophore ...
-
bioRxiv - Microbiology 2019Quote: ... An external calibration with ESI-L Low Concentration Tuning Mix (Agilent technologies) was performed prior to data collection and internal calibrant Hexakis(1H,1H,3H-tertrafluoropropoxy)phosphazene was used throughout the runs ...
-
bioRxiv - Systems Biology 2021Quote: ... for CAT and EnVision FLEX Target Retrieval Solution Low pH (50x) (Dako) for NUDT19 ...
-
bioRxiv - Cell Biology 2019Quote: ... 2007) as a template to introduce the A63V change by the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies). The ASNA-1A63V::GFP containing plasmid (pGK200 ...
-
bioRxiv - Cell Biology 2020Quote: We constructed the MELT motif mutants of Spc105 using the QuickChange II XL Site-Directed mutagenesis kit (Agilent Technologies). To build pAJ737 (Spc105_#4-6 in #1-3) ...
-
bioRxiv - Genetics 2021Quote: ... the 1 kb fragment including human FTO SNP rs1421085_T (the reference allele) and rs1421085_C (the minor allele) were constructed using the QuikChange II site-directed mutagenesis kit (Stratagene) and inserted in forward or reverse orientation ahead of hFTOp into the pGL4.12 vector ...
-
bioRxiv - Microbiology 2021Quote: ... The NS gene segments of A_NS237 and B_NS217 were modified using QuikChange II Site Directed Mutagenesis Kit according to the instruction manual (Agilent, Germany). The sequence of mutagenesis primers is available upon request.
-
bioRxiv - Evolutionary Biology 2020Quote: ... Site-directed mutagenesis of the Spk-1 gene in pNR139.5 and pNR141.1 was performed essentially as described by the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies). For pNR139.5 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We produced the promoter inserts by performing error-prone PCR using the GeneMorph II Random Mutagenesis Kit (Agilent Technologies). We used the plasmid constructs with MG1655 promoter variants cloned into them as template DNA for the error-prone PCR aiming to achieve approximately 1.5 SNPs per promoter sequence ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Site mutagenesis was performed on pCMV4 CYP2D6*1 plasmid23 with QuikChange II Site-Directed Mutagenesis Kit (Agilent, CA, US). Plasmid cDNA encoding variants with the following amino acid exchanges were created ...
-
bioRxiv - Biochemistry 2019Quote: Site directed mutagenesis were performed according to standard protocol from the QuickChange II Site-Directed Mutagenesis kit (Agilent Technologies). The only difference was that E ...
-
bioRxiv - Developmental Biology 2019Quote: ... Arg-177-Ala mutants were generated in pCR II-TOPO TA vector using QuikChange site directed mutagenesis kit (Agilent). The wild type and the respective modifications were confirmed by DNA sequencing ...
-
bioRxiv - Neuroscience 2020Quote: ... Mutants were generated with site-directed mutagenesis using synthetic oligonucleotides and Quick Change II XL mutagenesis kit (Agilent Technologies). An additional human Ntrk2 fusion construct (SQSTM1 fused to TrkB kinase (Stransky et al. ...
-
bioRxiv - Biophysics 2021Quote: ... G553I) variants were created using the QuikChange II Site-Directed Mutagenesis Kit according to manufacturer’s instructions (Agilent Technologies, #200523). All plasmids were sequenced to confirm their identity (Genewiz).
-
O-GlcNAcylation reduces phase separation and aggregation of the EWS N-terminal low complexity regionbioRxiv - Biochemistry 2021Quote: ... The K842M mutation was introduced via Site-Directed Mutagenesis using a QuikChange II Kit (Agilent, Santa Clara, CA, USA).
-
bioRxiv - Biochemistry 2020Quote: ... The LaGH13_31B Y295A variant was generated using primers in Table S3 and the QuickChange II Site-Directed Mutagenesis kit (Agilent) with pET-28a(+)-LaGH13_31B as template ...
-
bioRxiv - Neuroscience 2020Quote: ... was generated by site directed mutagenesis using primers oM18_17 and oM18_18 (Table 1) and a Quikchange II Site-directed Mutagenesis kit (Agilent, 200523). The PCR product was digested with DpnI enzyme to remove template vector and transformed into Stbl2 chemically competent cells (Thermo Fisher ...
-
bioRxiv - Microbiology 2022Quote: ... Amino acid substitutions and deletions were introduced into pET28b vectors with the QuickChange II Site-Directed mutagenesis kit (Stratagene), according to the manufacturer’s directions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Site directed mutagenesis was performed following the manufacturer’s protocol using the Quick-Change II site-directed mutagenesis kit (Agilent Technologies ...
-
bioRxiv - Biophysics 2022Quote: Site-directed mutagenesis of the human yb-1 coding gene was carried out directly on the pET22b-YB-1_1-180 expression plasmid by using the “Quikchange II XL site-directed mutagenesis kit” from Stratagene and appropriate oligonucleotides (Eurofins Genomics) ...
-
bioRxiv - Biophysics 2022Quote: ... G553I) variant were cloned using the QuikChange II Site-Directed Mutagenesis Kit according to manufacturer’s instructions (Agilent Technologies, #200523). All plasmids were sequenced to confirm the correct sequences (Genewiz).
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding the single-mutation variants found in P.1 and 10-mutation variant (BZΔ10) were generated by Quikchange II XL site-directed mutagenesis kit (Agilent). Recombinant Indiana VSV (rVSV ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We produced the promoter inserts by performing error-prone PCR using the GeneMorph II Random Mutagenesis Kit (Agilent Technologies). We used 25 ng of the plasmid construct with the MG1655 lacZ promoter variant cloned into it as a template DNA for the error-prone PCR to achieve approximately 1.5 SNPs per variant sequence ...
-
bioRxiv - Cancer Biology 2019Quote: ... The pBabe-KRAS point mutation Q61H was created by using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) following the recommended protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Pair1 and Rejoin1 mutations were introduced using the site-directed mutagenesis commercial kit QuickChange® II XL (Agilent, CA) according to the manufacture’s protocol ...
-
bioRxiv - Plant Biology 2019Quote: ... The Msrab11f1(S29N) mutant was generated using QuikChange II Site-Directed Mutagenesis Kits performed according to the manufacturer’s manual (Stratagene) with the primers CTGGAGTTGGGAAAAACAATCTGCTTTCAAGG ...
-
bioRxiv - Neuroscience 2019Quote: ... Extracted RNA genomes were converted to complementary DNA using an AccuScript PfuUltra II RT-PCR kit (Agilent Technologies, USA) at 42°C for 2 hours with the following barcoded primer annealing to the rabies virus leader sequence ...
-
bioRxiv - Cell Biology 2019Quote: Methionine153 on pHluorin in pcDNA3.1-pHluorin-CD6320 was mutated to Arginine using QuickChange II XL Site-Directed Mutagenesis Kit (Agilent) with a pair of primers (Forward ...
-
bioRxiv - Cancer Biology 2019Quote: ... Mutant ORFs (FGFR2 M538I, N550K and K660N) were made using QuickChange II site-directed mutagenesis kit (Agilent Technologies #200523). Most stable cells lines express ORFs in pLX317 vector and were selected with puromycin (Life Technologies #A1113803) ...
-
bioRxiv - Immunology 2020Quote: ... and subsequently mutagenized by error-prone PCR (ePCR) via the GeneMorph II Random Mutagenesis Kit (Agilent Technologies, Cat # 200550) with a target nucleotide mutation frequency of 0–4.5 mutations per kilobase of DNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... The miR159 recognition site was altered by directed mutagenesis using a QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies); the amino acid sequence was not changed ...
-
bioRxiv - Genetics 2019Quote: ... Serine-to-alanine mutation was generated using QuikChange II XL Site-directed Mutagenesis Kit (Agilent Technologies, CA, USA 200522) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and S311A mutations were introduced by site directed mutagenesis using the QuikChange II Site-directed mutagenesis kit (Agilent #200521) and the following primers:
-
bioRxiv - Biophysics 2020Quote: ... Mutagenesis of of tubbyCT was done using QuikChange II XL Site-Directed mutagenesis kit (Stratagene, Agilent Technologies, Waldbronn, Germany).
-
bioRxiv - Microbiology 2020Quote: The plasmid HIV-1ΔEnv INHA (D116A)ΔNef was obtained by insertional mutagenesis using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent). HIV-1 viruses were produced by cotransfection with calcium phosphate with 10 μg HIV-1 LAI (BRU ...
-
bioRxiv - Immunology 2021Quote: ... The site directed mutagenesis was conducted with QuikChange II Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA, United States) in accordance with the manufactur’s instructions ...
-
bioRxiv - Immunology 2020Quote: Point mutations by site-directed mutagenesis were introduced in env constructs using the QuikChange II kit (Agilent Technologies Inc.) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... The catalytically inactive ATGL(S47A) mutant was was made by site directed mutagenesis using the QuickChange II kit (Stratagene). PLIN2-GFP was a generous gift from Carole Sztalryd (University of Maryland) ...
-
bioRxiv - Genetics 2019Quote: ... Single base-pair SMD-CRD missense variants were then introduced using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, Cat # 200521 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The resulting two vectors were then subjected to site-directed mutagenesis (QuickChange II XL Site-Directed Mutagenesis Kit; Agilent Technologies ...