Labshake search
Citations for Agilent :
651 - 700 of 7234 citations for Human Low affinity immunoglobulin gamma Fc region receptor II c FCGR2C ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... All compounds reported were confirmed by low-resolution MS (Agilent 6120 Quadrupole LCMS system ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... low pH∼6 (Dako, K8005; Agilent, Santa Clara, CA, USA), with preheating to 80°C and increased temperature to 95°C for 20min after slides were added ...
-
bioRxiv - Biochemistry 2023Quote: ... ESI-L Low Concentration Tuning Mix (Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Microbiology 2021Quote: ... Subsequent antibody incubation was performed at 4°C overnight or for one hour at room temperature using Dako polyclonal goat anti-rabbit or anti-mouse immunoglobulins/HRP (Agilent Technologies, USA). Membranes were washed using 0.1% TBS-T and proteins were detected using ECL or ECL Select (GE Healthcare ...
-
bioRxiv - Cell Biology 2022Quote: ... IgG1a monoclonal antibody in PBS with 1% BSA followed by a bridge step labelling with a polyclonal Rabbit Anti-Mouse Immunoglobulins (Dako, 1:50) and protein A-gold 10 nm (UMC Utrecht ...
-
bioRxiv - Physiology 2022Quote: ... Immunologic), the HRP-Anti-Rat IgG (MP-7444, Vector) for 45 min or the Goat Anti-Mouse Immunoglobulins/HRP (Dako-Agilent, P0447) at 1:100 for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... incubated with secondary antibodies diluted in 0.5% WBR in TBST for 1 hour at room temperature (Polyclonal Goat Anti-Rabbit Immunoglobulins/HRP, Agilent Dako #P0448, 1/2000), washed three times with TBST ...
-
bioRxiv - Cancer Biology 2023Quote: ... After performing Fc block by using blocking buffer (Dako, X0909), cells were stained by CD24 (Abcam ...
-
bioRxiv - Biochemistry 2019Quote: ... Mutagenesis of the human l/r-pyk gene was performed with a QuikChange kit (Stratagene). Proteins were expressed in the FF50 strain of Escherichia coli 8 that has both native E ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-exome libraries were prepared using a SureSelectXT Human All Exon V5 kit (Agilent Technologies). The RNA seq library from tumor RNA was prepared using Illumina TruSeq Stranded mRNA Library Prep Kit as per the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2021Quote: Libraries were generated using the Agilent SureSelect Human All Exon V6 kit (Agilent Technologies, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2023Quote: ... genomic DNA libraries were prepared using the SureSelect Human All Exon V6 kit (Agilent Technologies). Exome libraries were subjected to next generation sequencing using DNBseq platform (MGI ...
-
bioRxiv - Genetics 2023Quote: ... exome enrichment was performed using the SureSelect Human All Exon 50 Mb Kit V5 (Agilent). Sequencing was done on a HiSeq4000 (Illumina ...
-
bioRxiv - Immunology 2024Quote: ... WES libraries were prepared using the SureSelect Human All Exon V8 Kit (Agilent; 5191-6873) and sequenced on either a NextSeq 2000 (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... Copy number altered regions were detected with Agilent Genomic Workbench (AGW) software v7.0 (Agilent Technologies) using the Aberration Detection Method 2 (ADM-2 ...
-
bioRxiv - Genomics 2020Quote: ... 1X Herculase II Polymerase buffer and 1X Herculase II polymerase (Agilent Technologies, USA). We immediately thermo-cycled samples with the following temperature-time profile ...
-
bioRxiv - Systems Biology 2019Quote: ... 20% of the total mixture was incubated at 37°C with PNGaseF and fractionated into 16 high pH reversed phase fractions using a 1260 Infinity II HPLC (Agilent Technologies, Santa Clara, CA) with a 4.6 × 150 mm XBridge C18 column and a 30 minute gradient (mobile phase A ...
-
bioRxiv - Developmental Biology 2022Quote: ... High quality total RNA (RNA integrity number = 10) was labelled with Cyanine 3 CTP using the Low Input Quick Amp Labelling Kit (Agilent Technologies-5190-2305), and purified using Qiagen’s RNeasy Mini Spin Columns ...
-
bioRxiv - Physiology 2022Quote: ... Point mutations were made using Quickchange II XL Site-Directed Mutagenesis kit (Agilent technologies, Santa Clara, CA). The human KCNQ2 and human KCNQ3 constructs were fused with sequence of the enhanced YFP at the carboxyl-terminal end ...
-
bioRxiv - Neuroscience 2019Quote: ... pPBase-BRAFwt was generated with quick change II XL single nucleotide site directed mutagenesis kit from Agilent according to the manufacturer protocol ...
-
bioRxiv - Immunology 2020Quote: ... and was probed using dCTP-32P labeled probes made using the PrimeIT II kit (Agilent, cat. 300385) and Roche Quick Spin Columns (TE ...
-
bioRxiv - Pathology 2019Quote: ... Sections were stained using the CSA II kit (Biotin-free catalysed signal amplification system; DAKO, Glostrup, Denmark) and 3,3’-diaminobenzidine (DAB) ...
-
bioRxiv - Cell Biology 2019Quote: ... H3 S10A and H3 S10E using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent technologies, cat#200521) according to manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2021Quote: ... site directed mutagenesis was carried out by using Quik Change II Site-Directed Mutagenesis Kit (Agilent, USA). The primers used were ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the homology arms containing plasmid was mutated using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, #200522) to delete the single-guide RNA (sgRNA ...
-
bioRxiv - Biochemistry 2021Quote: ... Site Directed Mutagenesis was carried out using the QuikChange Lightning II cloning kit (Agilent, Santa Clara, CA). PCR cloning was carried out using the NEB PCR cloning kit ...
-
bioRxiv - Biochemistry 2020Quote: ... All mutants of IFITM3 were generated by using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies, #200523). Lipofectamine 3000 from Thermo Scientific was used for transfection of HEK293T cells.
-
bioRxiv - Cell Biology 2021Quote: ... The QuikChange II XL direct-mutagenesis kit was obtained from Stratagene (cat#200522, La Jolla, CA, USA) and the Vybrant Apoptosis Pacific Blue-annexin V kit and 7AAD from Invitrogen (cat#A35122).
-
bioRxiv - Microbiology 2021Quote: ... Point mutants were generated using the QuikChange II site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... were generated using the QuikChange II XL site-directed mutagenesis kit according to the manufacturer’s instructions (Agilent). To make the constructs for expression of stabilized soluble S2P spike trimer proteins ...
-
bioRxiv - Microbiology 2022Quote: ... Altered rsmY and rsmZ reporters were constructed using the QuikChange II XL site-directed mutagenesis kit (Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... site-directed mutagenesis was performed on pCMVΔR8.91 using the QuickChange II-XL site-directed mutagenesis kit (Agilent) according to manufacturer’s instructions and using the primers listed in Supplementary Table 1 ...
-
bioRxiv - Genetics 2019Quote: ... the C583Y mutation was introduced into the slc12a7a/kcc4a pXT7 construct using a QuikChange II Kit (Agilent) as per the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2019Quote: ... Radioactive probes were synthesized using a Prime-It II Random Primer Labeling Kit (300385, Agilent Technologies, Inc).
-
bioRxiv - Microbiology 2020Quote: ... Two rounds of error-prone PCR were performed using the GeneMorph II Random Mutagenesis Kit (Agilent Technologies). The PCR product was cloned into the PADL22c vector and transformed via electroporation into the TG1 E ...
-
bioRxiv - Genetics 2021Quote: ... Two oligos (F: GCGATGCCACCTAGGGCAAGCTGACCCTG and R: CAGGGTCAGCTTGCCCTAGGTGGCATCGC) were used with the QuikChange II mutagenesis kit (Agilent, 200523). We confirmed that this mutation (GFPstop ...
-
bioRxiv - Pathology 2020Quote: ... Site-directed mutagenesis was performed with the QuikChange® II XL Site-Directed Mutagenesis Kit (Agilent Technologies) and primers were designed using the QuikChange Primer Design tool (Agilent Technologies).
-
bioRxiv - Immunology 2020Quote: Viral mutants were generated by site-directed mutagenesis using the Quikchange II Site-directed mutagenesis kit (Agilent) with forward and reverse primers specific for each mutation (Key Resources Table) ...
-
bioRxiv - Genetics 2019Quote: ... The catalytically inactive point mutation C265S43 was introduced using the QuikChange II site-directed mutagenesis kit (Agilent) to create T7-DNMT3B2 catalytic dead (CD) ...
-
bioRxiv - Microbiology 2019Quote: ... point mutants were generated using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... These SNPs were made using the Quik Change II XL Site-Directed Mutagenesis Kit (Agilent Technology, 200521). The gRNA and c(3)GccΔ1 homologous repair template plasmid were sent to Genetivision (Houston ...
-
Gatekeeper helix activates Golgi SM protein Sly1 and directly mediates close-range vesicle tetheringbioRxiv - Cell Biology 2020Quote: ... a library of SLY1* mutant alleles was constructed using the GeneMorph II Random Mutagenesis Kit (Agilent #200550). The SLY1 open reading frame was amplified using the “medium mutation rate” PCR protocol ...
-
bioRxiv - Cell Biology 2019Quote: Generation of pGDB-SDEL plasmid was done using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) on the pGDB plasmid with primers P1 and P2 per the manufacturer’s protocol36.
-
bioRxiv - Biophysics 2019Quote: ... Point mutations were made using Quickchange II XL Site-Directed Mutagenesis kit (Agilent technologies, Santa Clara, CA). The sequences of the DNA constructs were confirmed by fluorescence-based DNA sequencing (Genewiz LLC ...
-
bioRxiv - Microbiology 2021Quote: ADAP1 and KRAS point mutants were generated using QuikChange II XL Site-Directed Mutagenesis kit (Agilent, 200522) per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Truncations were generated by stop codon insertion mutagenesis with QuikChange II XL mutagenesis kit (Agilent, cat# 200522), and GFP fusion expressing the STAT2 CC domain alone was constructed by PCR with specific primers to enable cloning into plasmid pEGFP-N1 or pEGFP-C1 ...
-
bioRxiv - Biochemistry 2022Quote: ... which was labelled with alpha-32P-ATP using the Prime-It II Random Primer Labelling Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Each mutagenesis reaction was performed using QuikChange II Site-directed Mutagenesis kit (Agilent, Santa Clara, CA, USA) and the mixtures were made according to manufactures guidelines ...
-
bioRxiv - Biophysics 2022Quote: ... Site-directed mutagenesis were introduced into plasmids using QuikChange II XL site-directed mutagenesis kit (Agilent Technologies) and confirmed by Sanger sequencing.
-
bioRxiv - Cell Biology 2022Quote: ... We generated the 873-1159-Citrine ΔNLS mutant using site-directed mutagenesis (QuikChange II Kit, Agilent Technologies) using the distal plasmid as a template ...