Labshake search
Citations for Agilent :
7851 - 7900 of 8609 citations for Cyclic GMP cGMP ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... 1 uL In-Fusion reaction mix was transformed into commercial chemically competent Escherichia coli (XL10-Gold, Agilent). Colonies were manually picked into Lysogeny broth supplemented with 100 μg/mL ampicillin in a 96-well block the next day after transformation and incubated in a shaker (MaxQ 5000 ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 mL gas sample of head space was withdrawn and injected into the gas chromatography (Agilent 7890B) utilizing a gas-tight syringe to measure ethylene concentration ...
-
bioRxiv - Genomics 2024Quote: ... DNA length was assessed by running 1 μl on a genomic screentape on the TapeStation 4200 (Agilent). DNA concentration was assessed using the dsDNA BR assay on a Qubit fluorometer (ThermoFisher) ...
-
bioRxiv - Genetics 2023Quote: ... Blocking was performed for 1 hour in PBS supplemented with 10% normal goat serum (NGS) (Agilent, X0907). The cells were incubated overnight at 4°C with primary antibodies (Supplementary table 4 ...
-
bioRxiv - Cell Biology 2023Quote: ... The membranes were further incubated with a goat anti-rabbit HRP-conjugated secondary antibody (1:2000, DAKO) for 1 h at room temperature ...
-
bioRxiv - Immunology 2023Quote: 1 x 105 BMDMs were seeded in Agilent Seahorse XF24 Cell Culture Microplate (Agilent Technologies, 100777-004) and treated as required by experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary anti-human von Willebrand factor (VWF) antibody (1:1000 dilution in PBS, LOT # 75601, Agilent Dako) was incubated overnight at 4°C ...
-
bioRxiv - Pathology 2023Quote: ... USA) and fragmentation analyzed by 1% agarose gel electrophoresis and High Sensitivity Bioanalyzer 2100 assay (Agilent Technologies).
-
bioRxiv - Neuroscience 2023Quote: ... sections were washed in PBS and incubated with a goat anti-mouse HRP IgG (1:100, Dako) secondary antibody for 30 min at RT ...
-
bioRxiv - Genetics 2023Quote: ... We pooled 1 μL of each library and fragment size was assessed with Bioanalyzer 2100 (Agilent™) using the High sensitivity DNA kit (#5067-4626) ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were immunoblotted with the following primary antibodies: polyclonal rabbit Anti-Human Tau (1:10 000, Dako) and monoclonal mouse Anti-Actin (1:25 000 ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated overnight at 4°C with anti-total tau primary antibody solution (1: 5000, DAKO A0024). After 1 hour incubation at RT in the corresponding secondary antibody solution (donkey anti-rabbit 800) ...
-
bioRxiv - Immunology 2023Quote: ... proteins were extracted from the cytosol fraction by incubation with 1% (v/v) StrataClean resin (Agilent Technologies) overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... Proteins were extracted from sucrose gradient fractions by incubation with 1% (v/v) StrataClean resin (Agilent Technologies) overnight at 4°C ...
-
bioRxiv - Bioengineering 2022Quote: ... anti-mouse-IgG conjugated to horseradish peroxidase (1:10,000, cat. no. P016102-2; Dako, Carpinteria, CA, USA), anti-rabbit StarBright 700 (1:2500 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were washed in TBST and probed with secondary antibodies: anti-rabbit HRP (Dako, P0448, 1:2000) for E-Cadherin and Vimentin ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary anti-human von Willebrand factor (VWF) antibody (1:1000 dilution in PBS, LOT # 75601, Agilent Dako) was incubated overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... using 1 µg/mL of rat anti-mouse IgM (AbD Biotec) or rabbit anti-mouse IgG1 (Dako) capture antibody ...
-
bioRxiv - Immunology 2023Quote: ... Images were acquired (1-5 images per subject) using the Cytation 5 Cell Imaging MultiMode Reader (Agilent). Images were processed to quantify fluorescence intensity using Gen5 software package 3.08.
-
bioRxiv - Cell Biology 2023Quote: ... membranes were washed 3 times with TBS-T and subsequently incubated with secondary antibodies (Dako, 1:5000) diluted in 5% marvel in TBS-T for 1 h at RT ...
-
bioRxiv - Plant Biology 2024Quote: ... Conjugated anti-rabbit and anti-mouse immunoglobulins were used as the secondary antibodies (Agilent Dako, 1:20000). Immunodetection was performed using an ECL Plus Western Detection Kit and revealed with an ImageQuant LAS 4000 mini CCD camera system (GE Healthcare) ...
-
bioRxiv - Plant Biology 2024Quote: ... Conjugated anti-rabbit and anti-mouse immunoglobulins were used as the secondary antibodies (Agilent Dako, 1:20000). Immunodetection was performed using an ECL Plus Western Detection Kit and revealed with an ImageQuant LAS 4000 mini CCD camera system (GE Healthcare) ...
-
bioRxiv - Neuroscience 2024Quote: ... The following primary antibodies were used in this study: rabbit anti-Tau (K9JA) (1:1000, #A0024, DAKO), chicken anti-MAP2 (1:2000 ...
-
bioRxiv - Microbiology 2024Quote: ... was performed in a 25 μL reaction mix comprising 1× TaqMan Brilliant II master mix (Agilent, UK), 0.05 pmol/μL forward primer (CCAACCGTGTGTTTCCTCCT) ...
-
bioRxiv - Cancer Biology 2021Quote: Deletion mutants of two TCF4 binding sites (TBE1 and TBE2) on the STUB1 promoter were generated as previously performed [25] using the Quickchange XL Site directed mutagenesis kit (Agilent technologies, Santa Clara, CA, USA) as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... the material was loaded onto denaturing PolyAcrylamide Gel Electrophoresis (dPAGE) at 12% or analyzed using the Agilent RNA 6000 Pico LabChip kit on an Agilent 2100 Bioanalyzer (Agilent Technology, Palo Alto, CA, USA). Of course ...
-
bioRxiv - Molecular Biology 2022Quote: ... Ser181Ala;Thr100Ala double mutant and Ser181Ala;Thr100Ala;Thr692Ala triple mutant were prepared using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, US) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... fragment distribution of the gDNA library was measured using the DNA 1000 Assay Kit with the Agilent Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA, USA). DNA libraries were sequenced with 150 base pair (bp ...
-
bioRxiv - Molecular Biology 2020Quote: ... One microliter of the purified RNA solution was used for electrophoresis using a Bioanalyzer 2100 with Agilent RNA nano or pico kit (Agilent Technologies, Santa Clara, CA, USA) to check for the quality.
-
bioRxiv - Molecular Biology 2021Quote: ... the steps were as follows: a) quality control using the Agilent 2100 Bio analyzer (Agilent RNA 6000 Nano Kit, Agilent Technologies, Santa Clara, CA, USA), b ...
-
bioRxiv - Molecular Biology 2020Quote: ... fluorescent chemistry and 1 ng was used to obtain RNA Integrity Number (RIN) using the Bioanalyzer RNA 6000 Pico kit (cat # 5067-1513, Agilent Technologies Inc., Santa Clara, USA). Lowest RIN was 9.3 ...
-
bioRxiv - Genetics 2019Quote: Site-directed mutagenesis for obtaining CDK2-Y15F and CDK2-Y15S cDNA was accomplished using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, La Jolla, CA; Cat# 210518) using primers sets mentioned in Table S3 ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNA was quantified using Nanodrop spectrophotometer ND-1000 and the integrity and purity were assessed by the Agilent 2100 Bioanalyzer and RNA 6000 Nano Labchip Kit (Agilent Biotechnologies, Palo Alto, CA, USA).
-
bioRxiv - Microbiology 2019Quote: ... Quantity and quality of total RNA and depleted RNA samples were assessed using the RNA 6000 Nano Lab Chip Kit on a Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA). Library preparation and sequencing were performed by SciLife (Stockholm ...
-
bioRxiv - Plant Biology 2019Quote: ... The quality and the quantity of cDNA was checked using the Agilent 2100 Bioanalyzer with the High Sensitivity DNA kit (Agilent Technologies, Santa Clara, CA, USA). cDNA was sheared using the COVARIS S2 system (Covaris Inc. ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and the quality and quantity of that pool was assessed via electrophoresis (High-Sensitivity DNA Kit and Agilent Bioanalyzer; Agilent Technologies, Santa Clara, CA, USA), real-time quantitative polymerase chain reaction (qPCR ...
-
bioRxiv - Immunology 2021Quote: ... The library was hybridized to biotinylated cRNA oligonucleotide baits from the SureSelect Human All Exon kit V6+somatic probe sets (Agilent Technologies Inc., Santa Clara, CA), and amplified for 12 cycles ...
-
bioRxiv - Immunology 2021Quote: ... RNA quantification and quality assessments were performed by ultraviolet–visible spectrophotometry (Nanodrop Technologies, Wilmington, DE) and the RNA 6000 Nano Chip Kit with the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). RNA quality of all samples reached a RNA integrity number (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... fluorescent chemistry and 1 ng was used to obtain RNA Integrity Number (RIN) using the Bioanalyzer RNA 6000 Pico kit (cat # 5067-1513, Agilent Technologies Inc., Santa Clara, USA). Lowest RIN was 9.1 ...
-
bioRxiv - Genetics 2022Quote: ... The purified RNA quality was evaluated through capillary electrophoresis in the Bioanalyzer 2100 with an RNA 6000 Nano LabChip Kit (Agilent Technologies, Santa Clara, CA, USA) and quantified using a Nanodrop spectrophotometer ...
-
bioRxiv - Genomics 2020Quote: ... The quality and yield of the prepared libraries were assessed using a high sensitivity Small DNA Fragment Analysis Kit (Agilent Technologies, Santa Clara, CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were labeled for microarray analysis using the One-Color Microarray-Based Gene Expression Analysis Low Input Quick Amp WT Labeling kit (Agilent Technologies, Santa Clara, CA, USA), according to the manufacturer’s instructions.
-
bioRxiv - Genetics 2022Quote: ... The length of the eluted DNA fragments was measured on a Femto Pulse using the Agilent Genomic DNA 165 kb kit (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s recommendations.
-
bioRxiv - Cancer Biology 2022Quote: ... for 1 hour at room temperature followed by treatment with HRP-conjugated anti-mouse secondary antibody (DAKO Envision Plus HRP kit, Dako Denmark A/S, Glostrup, Denmark) for 30 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA yield was quantified with a NanoDrop Spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) and RNA integrity was assessed with Bioanalyzer 2100 RNA 6000 Nano Kit (Agilent Technologies, Santa Clara, CA, USA). All samples had an RNA Integrity Number (RIN ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were eluted in RNAse-free water and purified RNA was analyzed using Qubit RNA HS Assay Kit (Thermo) and Agilent TapeStation 4200 (Agilent Technologies, Santa Clara, CA, USA) using the RNA High Sensitivity assay ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA of each sample was synthesized from 10 μg of total RNA using the FairPlay III Microarray Labeling Kit (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... according to the manufacturer protocol and complementary DNAs were generated using an AccuScript High Fidelity 1st Strand cDNA Synthesis kit (Agilent Technologies, Santa Clara, VA, USA). A quantitative PCR was performed using a QuantStudio™ 3 Real-Time PCR system (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... RNA integrity was defined by capillary electrophoresis with an RNA 6000 Nano Lab-on-a-Chip kit and Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA). Only if the integrity number values of RNA were more than 6 ...
-
bioRxiv - Microbiology 2019Quote: ... the material was loaded onto denaturing polyacrylamide gel electrophoresis (dPAGE) at 12% or analysed using the Agilent RNA 6000 Pico LabChip kit on an Agilent 2100 Bioanalyzer (Agilent Technology, Palo Alto, CA, USA). Controls were carried out under the same conditions ...