Labshake search
Citations for Agilent :
651 - 700 of 982 citations for Dog Trefoil Factor 3 TFF3 Protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Scanning of microarrays was performed with 3 μm resolution (8×60K) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were processed with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were subsequently diluted to adjust the HNO3 concentration to 3 % and ICP-MS was performed with a Hewlett-Packard 4500 ICP mass spectrometer (Agilent Technologies) connected to a CETACASX-500 auto-sampler for sample injection ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA was labeled with Hoechst (1:2000) for 3 min and the sections were mounted using fluorescence mounting media (Dako, S3023). All images were taken using a Zeiss Observer Z1 fluorescent microscope using a 10X objective ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR was performed in technical triplicates from at least 3 independent biological samples using the SYBR green Brilliant II fast kit (Agilent Technologies) on an Mx3005p apparatus (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were injected into a C18 reverse phase column (Atlantis T3, 2.1 × 150 mm, 3 μm; Waters) using HPLC (Agilent 1290 LC) at a flow rate of 0.15□ml/min with 5 mM ammonium formate for mobile phase A and 100% methanol for mobile phase B ...
-
bioRxiv - Bioengineering 2024Quote: ... Bevacizumab-sensitive/resistant U87 cells were cultured identically to wild-type U87 cells.79 Cells were screened for mycoplasma every 3 – 4 months with the MycoSensor qPCR Assay Kit (Agilent Technologies).
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pooled library was quality checked on an Agilent TapeStation System by mixing 3 µL D1000 Sample Buffer (Agilent 5190-6502) with 1 µL pooled library and running in D1000 ScreenTape (Agilent 5067-5582) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and absorbance was measured at 562 nanometers using the Bio-Tek Cytation 3 Multi-Mode Reader (Agilent, Santa Clara, CA, USA). The proteins were run on a 10% SDS-polyacrylamide gel ...
-
bioRxiv - Physiology 2023Quote: ... The metabolic function of activated CD4+ T cells cultured for 3 days in vitro was analyzed by measuring the extracellular acidification rate (ECAR) using an XFe96 extracellular flux analyzer (Seahorse Bioscience). The cells were kept in XF media (Seahorse Bioscience ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Biochemistry 2023Quote: ... (3) RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Bioengineering 2023Quote: ... PHA was extracted from lyophilized sludge using acidified methanol (3% sulfuric acid) containing chloroform and analyzed using a gas chromatography-mass spectrometry (Agilent, USA). Glycogen in sludge was extracted in a similar way but using 0.9M HCl and analyzed using a liquid chromatography-mass spectrometer (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was cross-linked by exposing the living cells twice to 4,5′,8-trimethylpsoralen at a final concentration of 10 μg/mL followed by 3’ irradiation pulses with UV 365-nm monochromatic light (UV Stratalinker 1800, Agilent Technologies). The cells were then washed repeatedly with cold PBS and lysed with a cell lysis buffer (1.28M sucrose ...
-
bioRxiv - Plant Biology 2024Quote: ... The samples were homogenized and the supernatant was loaded onto a Bond Elut C18 cartridge (100 mg, 3 ml; Agilent Technologies) and eluted with 80% (v/v ...
-
bioRxiv - Microbiology 2024Quote: ... 100 μL was aliquoted in a 96-well plate in triplicates and the absorbance at 550 nm was measured every 10 s for 3 min using a BioTek Synergy H1 plate reader (Agilent Technologies). Then ...
-
bioRxiv - Immunology 2024Quote: ... and 2-3 x 105 NK cells per well were seeded in triplicates in Seahorse XF RPMI medium (Agilent, 103576-100) supplemented with 2 mM L-glutamine (Agilent ...
-
bioRxiv - Cancer Biology 2024Quote: ... Supernatants were loaded into pre-conditioned Phenomenex Strata XL-100 60 mg/3 ml cartridges (Torrance, CA) and passed through it using positive pressure manifold (Agilent Technologies). Flow through was collected subsequently and 100 µL of filtrate was mixed with 100 µL of water for the LC-MS/MS system ...
-
bioRxiv - Microbiology 2024Quote: ... such as the uncut PT oligos and the four 3-mer release oligos (CCA, CCC, CCG, and CCT) using an HPLC system (Agilent 1290) as outlined below ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.6 mg mL−1 enzyme with 2 mM nicotine was incubated at 30°C for 3 days before mass spectrometry on 6545 Q-TOF LC/MS system (Agilent, USA) in positive mode ...
-
bioRxiv - Developmental Biology 2024Quote: miR-92b-3p binding sites in each 3’UTR were mutated using the QuikChange II XL site-directed mutagenesis kit (Agilent, #200517) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... primary cultured chondrocytes were seeded at a density of 3 × 104 cells per well into an 8-well Seahorse culture plate (Seahorse Bioscience). For OCR analysis ...
-
bioRxiv - Genomics 2021Quote: ... using a mixture of equal volume of ready-to-use protein block serum-free solution (Agilent Dako, cat.no ...
-
bioRxiv - Cancer Biology 2021Quote: ... were immobilized on each Protein-A cartridge (25 µL bed volume, Agilent Technologies, cat. no. G5496-60018) and crosslinked ...
-
bioRxiv - Cell Biology 2020Quote: ... Coverslips were rinsed in PBS three times and incubated in serum free DAKO Protein Block (X0909, DAKO) for 1h at RT ...
-
bioRxiv - Immunology 2021Quote: ... and capillary electrophoresis sodium dodecyl sulphate (CE-SDS; protein 230, BioAnalyzer 2100, Agilent, Santa Clara, CA, USA).
-
bioRxiv - Biochemistry 2020Quote: Skd3 variants were expressed as an N-terminally MBP-tagged protein in BL21 (DE3) RIL cells (Agilent). Cells were lysed via sonication in 40mM HEPES-KOH pH=7.4 ...
-
bioRxiv - Cancer Biology 2020Quote: ... After blocking nonspecific-binding sites on sections with Protein Block Serum-Free reagent (Dako North America Inc.) for 30 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: Scanning mutant libraries were constructed using saturation mutagenesis using the QuikChange HT Protein Engineering System from Agilent following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... After blocking nonspecific-binding sites on sections with Protein Block Serum-Free reagent (Dako North America Inc.) for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... FcR binding was quantified by incubating immune complexes with biotinylated FcRs (FcγR2A-1, FcγR2A-2, FcγR3A, courtesy of Duke Protein Production Facility) conjugated to Steptavidin-PE (Prozyme). Flow cytometry was performed with an IQue (Intellicyt ...
-
bioRxiv - Cell Biology 2022Quote: ... cells or tissue sections were incubated with Protein Block Serum-Free Ready-To-Use (Dako, #X 0909) for 30 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: Constructs encoding the 6His-SUMO tagged proteins were transformed into chemically competent BL21(DE3) Escherichia coli (Agilent). A fresh bacteria colony was inoculated to 10 ml LB broth containing 200 μg/ml Ampicillin and 50 μg/ml Chloramphenicol and grown at 37°C overnight ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and slides were incubated with Dako Serum Free Protein Block (#X090930-2, Agilent, Santa Clara, CA, USA) at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... proteins were diluted and scanned in a quartz cuvette with a Cary 60 UV-Vis spectrophotometer (Agilent). Extinction coefficients for Cas9 ...
-
bioRxiv - Biochemistry 2020Quote: ... All E protein variants were obtained by site-directed mutagenesis using QuikChange kit (Stratagene, La Jolla, California) and were confirmed by sequencing the plasmid DNA at Macrogen Company (Seoul ...
-
bioRxiv - Cell Biology 2021Quote: ... A53T and E46K α-synuclein proteins were expressed in BL2-Gold(DE3) competent cells (Agilent, Cat #230132). Protein expression was induced at log phase with 200 μM IPTG for 16 hours at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The immunoprecipitated proteins were analyzed using a precision HPLC unit (1100 series, Agilent, Santa Clara, CA, USA) equipped with a reverse-phase column and a micro-analytical UV detector system (SG Highteco ...
-
bioRxiv - Molecular Biology 2021Quote: Protein expression was conducted in E.coli BL21 (DE3) Codon Plus cells (Agilent Technologies, San Diego, CA, USA). Induced cultures were grown at 18° C overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... 600 ng of total protein was injected onto a home-packed PLRP column (PLRP-S) (Agilent Technologies), 10-µm particle size ...
-
bioRxiv - Biochemistry 2023Quote: The EQ2 mutations were introduced sequentially into each protein using QuikChange II Site-Directed Mutagenesis (Agilent Technologies) with all growth media supplemented with 0.4% (w/v ...
-
bioRxiv - Biochemistry 2023Quote: ... The maltose-binding protein (MAL) gene from Escherichia coli (gene identifier 7129408) in a pBlueScript KS (Stratagene) was amplified by PCR using T7 minimal promoter primers under the following conditions ...
-
bioRxiv - Immunology 2023Quote: ... proteins were extracted from the cytosol fraction by incubation with 1% (v/v) StrataClean resin (Agilent Technologies) overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... Proteins were extracted from sucrose gradient fractions by incubation with 1% (v/v) StrataClean resin (Agilent Technologies) overnight at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... metabolic labelling was performed in BOEC protein extracts using ENG mAb SN6h (Dako Denmark A/S, Denmark). Modifying methods of Pece et al,18 a 1 hour “pulse” with 50μCi/ml of 35S methionine ...