Labshake search
Citations for Agilent :
551 - 600 of 982 citations for Dog Trefoil Factor 3 TFF3 Protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... For signal detection the MACH 3 Mouse HRP Polymer Detection system was employed according to manufacturer’s protocol using DAB+ (Fa.Agilent Technologies, K3468). Slides were counter-stained with Hematoxylin Gill’s Formula (Fa.Vector ...
-
bioRxiv - Microbiology 2022Quote: All of the indicated mutations were introduced into a plasmid backbone expressing His6 tagged pNL4-3-derived IN by QuikChange site directed mutagenesis kit (Agilent) (66) ...
-
bioRxiv - Neuroscience 2020Quote: ... DI rinse and wash buffer prior to a 3-minute incubation with Haematoxylin ready-to-use solution (K8018, Agilent DAKO) and a further DI rinse and wash step ...
-
bioRxiv - Neuroscience 2020Quote: ... DI rinse and wash buffer prior to a 3-minute incubation with Haematoxylin ready-to-use solution (K8018, Agilent DAKO) and a further DI rinse and wash step ...
-
bioRxiv - Neuroscience 2021Quote: RNA-seq libraries were prepared for each time-points and seady-state sample using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD for Illumina (Lexogen) automated on the NGS WorkStation (Agilent) at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Cancer Biology 2021Quote: ... slides were de-waxed and antigen retrieval was performed in a pressure cooker at 125°C for 3 min employing an Antigen Retrieval solution (Dako, pH6 for EZH2 ...
-
bioRxiv - Microbiology 2022Quote: ... 50 mg/mL glycogen (1/50 vol/vol and 3 volumes of 100% ethanol. The quality of the isolated RNA was assessed on an Agilent Bioanalyzer ...
-
bioRxiv - Immunology 2022Quote: ... the ELISA plates were washed 3 times with TBS buffer and a rabbit anti-human HRP antibody 1:3000 (Dako) in blocking solution was applied for 1 hour (RT ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Peptides were trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and then separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were first trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) before being separated on an analytical column (Agilent Poroshell EC-C18 ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... Peptides were first trapped (Dr. Maisch Reprosil C18, 3 μm, 2 cm × 100 μm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Plant Biology 2021Quote: ... and cloned into pVp16-Dest vector for IPTG (isopropyl-β-thiogalactopyranoside)-induced expression (3 h at 37°C) in E.coli strain ArcticExpress (Agilent). After sonication ...
-
bioRxiv - Molecular Biology 2021Quote: ... Then all membranes were washed 3 times and mounted on coverslips using an aqueous fluorescent mounting medium (DakoCytomation, Huddinge, Sweden). Samples were analysed with Leica TCS SP8 confocal microscope (Leica Microsystems ...
-
bioRxiv - Neuroscience 2021Quote: ... free floating sections were blocked with 3% donkey serum and incubated overnight with either rabbit anti-GFAP (1:10000, Dako), rat anti-CD68 (1:200 ...
-
bioRxiv - Cancer Biology 2021Quote: ... SPEC-PTSCX sample cleanup pipette tips and Bond Elut C18/ 3 mL cleanup cartridges were from Agilent (Santa Clara, CA), cell culture slides (8-chamber ...
-
bioRxiv - Developmental Biology 2021Quote: ... pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent). The same kit was used to sequentially remove three nucleotides located at the 5’ end of the pCS2+-3’HA-sobp ORF to generate a construct whose transcribed mRNA does not bind to the designed translation-blocking antisense morpholino oligonucleotide (pCS2+-sobpMOI-3’HA ...
-
bioRxiv - Cell Biology 2020Quote: ... 6 PCR reactions including two biological replicates and 3 technical replicates per gene were performed using Brilliant SYBR master mix (Agilent), running cycles of 10 minutes at 95°C ...
-
bioRxiv - Molecular Biology 2021Quote: Primary brown adipose cells were isolated and cultured for 3 days before plated in XF cell culture microplates (Seahorse Bioscience). Cells (10,000 cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peptides were trapped (Dr. Maisch Reprosil C18, 3 µm, 2 cm x 100 µm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
bioRxiv - Genetics 2020Quote: Single variants were introduced by mutagenesis of the Tile 3-KCNH2 plasmid (Table S1) using the Quikchange Lightning Multi kit (Agilent), with 1 primer per variant ...
-
p97/VCP induces GLI1 to control XBP1-dependent endoplasmic reticulum stress transcriptional responsebioRxiv - Cancer Biology 2021Quote: ... The cells were washed 3 times with PBS for 5 min and then incubated with a secondary antibody: Flex-HRP (EnVision System, Dako) for 30 min and washed 3 times 5 min with PBS ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were resuspended in FACS staining buffer (3% FBS in PBS) and analyzed by flow cytometry on a Novocyte 3000 (Agilent). Flow cytometry results were analyzed using NovoExpress (version 1.5.6).
-
bioRxiv - Microbiology 2023Quote: ... solution and 3 μl of each sample were subjected to high-resolution liquid chromatography-mass spectrometry (LC-MS) analysis (Agilent iFunnel 6550 quadrupole time-of-flight (QTOF) ...
-
bioRxiv - Microbiology 2023Quote: ... along with gene-specific primers listed in Supplemental Table 3 and qPCR was performed in technical triplicate on a StepOnePlus (Stratagene). Ct values of target genes were normalized to β-actin and relative gene expression levels between conditions were calculated via the ΔΔCt method ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Cell Biology 2023Quote: ... GEMs were used to generate barcoded cDNA libraries following the manufacturer’s protocol (Single Cell 3’ Reagent Kit v3.1, 10X Genomics) and quantified using the TapeStation High Sensitivity D5000 kit (Agilent, Germany). Subsequently ...
-
bioRxiv - Microbiology 2023Quote: ... of HIV-1 were amplified by PCR using KOD-Plus-Neo and pNL4-3 as a template and cloned into pBluescript II KS(-) (212208, Agilent). The MLV 5’-LTR (1 - 207 nt ...
-
bioRxiv - Microbiology 2023Quote: ... Peptides were acidified with trifluoroacetic acid (TFA) to lower the pH below 3 and desalted on reversed phase (RP) C18 OMIX tips (Agilent). The tips were first washed 3 times with 100 µl pre-wash buffer (0.1% TFA in water/acetonitrile (ACN ...
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... The HLA-I affinity chromatography was performed using a 96-well single-use micro-plate with 3 μm glass fiber and 10 μm polypropylene membranes (Agilent). Sep-Pak tC18 100 mg Sorbent 96-well plates (Waters ...
-
bioRxiv - Microbiology 2022Quote: ... and tRNA was isolated to purity from the small RNA fraction following HPLC on the Bio SEC-3 column (Agilent; 7.8 mm ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: All of the mutations were introduced into a plasmid backbone expressing 6xHis tagged pNL4-3-derived IN by QuikChange site-directed mutagenesis kit (Agilent). The plasmids containing full-length WT and mutants were transformed into BL21 (DE3 ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were washed with PBS for 15 mins (3×5min fresh solution) and cover-slipped with fluorescent mounting medium (Dako).
-
bioRxiv - Immunology 2024Quote: ... residues D141 of Regnase-1 and D252 of Regnase-3 were mutated to asparigines using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were washed 3 times for 10 minutes each with TBST and probed with appropriate HRP secondary antibody (anti-Rabbit Immunoglobulin/HRP, Dako P044801 or anti-mouse Immunoglobulin/HRP ...
-
bioRxiv - Physiology 2023Quote: ... The cells were transfected with 100 ng of NF-κB firefly luciferase reporter plasmid p(NF-κB)3-Luc (Stratagene) and 10 ng of Renilla luciferase reporter plasmid pRL-RSV (Promega) ...
-
bioRxiv - Physiology 2023Quote: ... Acetone was measured using an Agilent DB-35MS column (30 m 3 0.25 mm i.d. x 0.25 µm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Physiology 2023Quote: ... and 4 μl of supernatant was injected into an HILIC column (HILIC Silica 3 μm, 2.1 × 150 mm, SN: 186002015; Atlantis) on a 1290 Infinity II LC System (Agilent Technologies) which is interfaced with a 6545 MS (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Molecular Biology 2023Quote: Size Exclusion Chromatography in line with Multi Angle Laser Light Scattering (SEC-MALLS) experiments for absolute mass determination were conducted at 25°C with a BioSEC-3 column (Agilent) equilibrated in 20 mM Na-phosphate pH 7.0 ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... LC-MS experiments were carried out on an Agilent 1100 Series LC with a Poroshell 120 EC-C18 column (100 × 3 mm, 2.7 µm, Agilent Technologies) and an Agilent G1956B Series Single Quadripole MS in positive ion mode for mass detection ...
-
bioRxiv - Cell Biology 2023Quote: ... All sections were washed three times for 3 min with PBS and mounted with Dako Fluorescent Mounting Medium (Agilent, USA).
-
bioRxiv - Molecular Biology 2022Quote: ... Phosphorylation site mutations and gRNA sequences were introduced into vectors by PCR amplification with mutagenic primers (Table 3) with Phusion (Thermo) or PfuUltra II (Stratagene) polymerase ...
-
bioRxiv - Cancer Biology 2022Quote: ... Glacial acetic acid was added to dissolve the crystals and the absorbance was measured at 595 nm with a Cytation 3 Image Reader (Agilent). The values of vehicle-treated controls were set to 100%.
-
bioRxiv - Microbiology 2022Quote: ... 30 sec at 60°C (steps 3 and 4 were repeated 40 times) was done with the AriaMX real-time PCR System (Agilent).