Labshake search
Citations for Agilent :
6851 - 6900 of 7497 citations for Human Adenosylhomocysteinase Like 1 AHCYL1 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The membranes were further incubated with a goat anti-rabbit HRP-conjugated secondary antibody (1:2000, DAKO) for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... The following primary antibodies were used in this study: rabbit anti-Tau (K9JA) (1:1000, #A0024, DAKO), chicken anti-MAP2 (1:2000 ...
-
bioRxiv - Microbiology 2024Quote: ... was performed in a 25 μL reaction mix comprising 1× TaqMan Brilliant II master mix (Agilent, UK), 0.05 pmol/μL forward primer (CCAACCGTGTGTTTCCTCCT) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 1-mm orbital shake in a BioTek Synergy H1 Multimode plate reader (Agilent Technologies, Inc., USA). Optical density at 600 nm (OD600 ...
-
bioRxiv - Cancer Biology 2021Quote: Deletion mutants of two TCF4 binding sites (TBE1 and TBE2) on the STUB1 promoter were generated as previously performed [25] using the Quickchange XL Site directed mutagenesis kit (Agilent technologies, Santa Clara, CA, USA) as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... the material was loaded onto denaturing PolyAcrylamide Gel Electrophoresis (dPAGE) at 12% or analyzed using the Agilent RNA 6000 Pico LabChip kit on an Agilent 2100 Bioanalyzer (Agilent Technology, Palo Alto, CA, USA). Of course ...
-
bioRxiv - Molecular Biology 2022Quote: ... Ser181Ala;Thr100Ala double mutant and Ser181Ala;Thr100Ala;Thr692Ala triple mutant were prepared using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, US) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... fragment distribution of the gDNA library was measured using the DNA 1000 Assay Kit with the Agilent Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA, USA). DNA libraries were sequenced with 150 base pair (bp ...
-
bioRxiv - Molecular Biology 2020Quote: ... One microliter of the purified RNA solution was used for electrophoresis using a Bioanalyzer 2100 with Agilent RNA nano or pico kit (Agilent Technologies, Santa Clara, CA, USA) to check for the quality.
-
bioRxiv - Molecular Biology 2021Quote: ... the steps were as follows: a) quality control using the Agilent 2100 Bio analyzer (Agilent RNA 6000 Nano Kit, Agilent Technologies, Santa Clara, CA, USA), b ...
-
bioRxiv - Molecular Biology 2020Quote: ... fluorescent chemistry and 1 ng was used to obtain RNA Integrity Number (RIN) using the Bioanalyzer RNA 6000 Pico kit (cat # 5067-1513, Agilent Technologies Inc., Santa Clara, USA). Lowest RIN was 9.3 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and the quality and quantity of that pool was assessed via electrophoresis (High-Sensitivity DNA Kit and Agilent Bioanalyzer; Agilent Technologies, Santa Clara, CA, USA), real-time quantitative polymerase chain reaction (qPCR ...
-
bioRxiv - Immunology 2021Quote: ... RNA quantification and quality assessments were performed by ultraviolet–visible spectrophotometry (Nanodrop Technologies, Wilmington, DE) and the RNA 6000 Nano Chip Kit with the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). RNA quality of all samples reached a RNA integrity number (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... fluorescent chemistry and 1 ng was used to obtain RNA Integrity Number (RIN) using the Bioanalyzer RNA 6000 Pico kit (cat # 5067-1513, Agilent Technologies Inc., Santa Clara, USA). Lowest RIN was 9.1 ...
-
bioRxiv - Genetics 2022Quote: ... The purified RNA quality was evaluated through capillary electrophoresis in the Bioanalyzer 2100 with an RNA 6000 Nano LabChip Kit (Agilent Technologies, Santa Clara, CA, USA) and quantified using a Nanodrop spectrophotometer ...
-
bioRxiv - Genomics 2020Quote: ... The quality and yield of the prepared libraries were assessed using a high sensitivity Small DNA Fragment Analysis Kit (Agilent Technologies, Santa Clara, CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were labeled for microarray analysis using the One-Color Microarray-Based Gene Expression Analysis Low Input Quick Amp WT Labeling kit (Agilent Technologies, Santa Clara, CA, USA), according to the manufacturer’s instructions.
-
bioRxiv - Genetics 2022Quote: ... The length of the eluted DNA fragments was measured on a Femto Pulse using the Agilent Genomic DNA 165 kb kit (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s recommendations.
-
bioRxiv - Cancer Biology 2022Quote: ... for 1 hour at room temperature followed by treatment with HRP-conjugated anti-mouse secondary antibody (DAKO Envision Plus HRP kit, Dako Denmark A/S, Glostrup, Denmark) for 30 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA yield was quantified with a NanoDrop Spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) and RNA integrity was assessed with Bioanalyzer 2100 RNA 6000 Nano Kit (Agilent Technologies, Santa Clara, CA, USA). All samples had an RNA Integrity Number (RIN ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were eluted in RNAse-free water and purified RNA was analyzed using Qubit RNA HS Assay Kit (Thermo) and Agilent TapeStation 4200 (Agilent Technologies, Santa Clara, CA, USA) using the RNA High Sensitivity assay ...
-
bioRxiv - Cell Biology 2021Quote: ... according to the manufacturer protocol and complementary DNAs were generated using an AccuScript High Fidelity 1st Strand cDNA Synthesis kit (Agilent Technologies, Santa Clara, VA, USA). A quantitative PCR was performed using a QuantStudio™ 3 Real-Time PCR system (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... RNA integrity was defined by capillary electrophoresis with an RNA 6000 Nano Lab-on-a-Chip kit and Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA). Only if the integrity number values of RNA were more than 6 ...
-
bioRxiv - Microbiology 2020Quote: Single point SCoV2-NTD-Fc N-linked glycosylation site mutants (N61, 74, 122, 149, 165, 234, 282Q) were generated using a QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA) to change the respective asparagine (N ...
-
bioRxiv - Microbiology 2020Quote: ... The synthesis and fluorescence labeling of cDNA followed a strand-specific method using the FairPlay III Microarray Labeling Kit (Agilent Technologies, Santa Clara, CA, USA) and actinomycin D (Calbiochem ...
-
bioRxiv - Immunology 2020Quote: ... and Ii L17A was subsequently used as template for PCR quick change mutagenesis (all reagents used were included in the kit; QuickChange® Site-Directed Mutagenesis (Stratagene, La Jolla, CA, USA)) in order to generate the AP-3 binding motif RRP 21 ...
-
bioRxiv - Immunology 2021Quote: ... was performed on an Illumina HiSeq 4000 machine using libraries prepared with a SureSelectXT Mouse All Exon capture kit (Agilent Technologies, Santa Clara, CA, USA), to produce 150 paired end reads sufficient for a mean bait coverage of at least 150x ...
-
bioRxiv - Immunology 2020Quote: ... The RNA Integrity Number (RIN) of all RNA samples were determined using an Agilent 2100 Bioanalyzer and Agilent RNA 6000 nano kit (Agilent Technologies, Santa Clara, CA, USA). A minimum RIN of 7.5 was used as the standard for inclusion in the gene expression study ...
-
bioRxiv - Cancer Biology 2022Quote: ... of matched-PBMC DNA was fragmented using the SureSelect XT HS and XT Low Input Enzymatic Fragmentation Kit following the manufacturer’s instructions (Agilent, Santa Clara, USA, cat # 5191-4080). Molecular-barcoded libraries were constructed following the SureSelect XT HT targeted enrichment protocol for Illumina paired-end multiplexed sequencing libraries (Version A1 ...
-
bioRxiv - Cancer Biology 2022Quote: Deletion of TBE consensus sites in the FOXM1 promoter was accomplished using the QuickChange XL Site-Directed Mutagenesis44 kit (Agilent Technologies, Santa Clara, CA, USA) by following manufacturer’s instructions and was then cloned into the pGL3 basic vector ...
-
bioRxiv - Pathology 2022Quote: ... The RNA Integrity Number (RIN) of all samples was quantified using an Agilent 2100 Bioanalyser and Agilent RNA 6000 nano kit (Agilent Technologies, Santa Clara, CA, USA). RIN values above 7.5 were used as the inclusion criterion for subsequent gene expression analysis ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA quality was evaluated by measuring the RNA integrity number (RIN) using an Agilent RNA 6000 Nano Kit with an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... The EGFP and mCherry dynamin-2 mutations A618T and S619L were constructed by site-directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA). Neuropeptide Y fused to mCherry (NPY-mCherry ...
-
bioRxiv - Neuroscience 2023Quote: ... We constructed the HPRT1-I42T cDNA from this clone by site-directed mutagenesis using the Quick Change II Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA). Primers sequences used to create the mutation are shown in Table S3 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The quality and integrity of the total RNA were determined using the Agilent 2100 Bioanalyzer and the RNA 6000 Nano LabChip Kit (Agilent, Santa Clara, CA, United States). A sequencing RNA library was constructed by performing a 3′-end linker ...
-
bioRxiv - Evolutionary Biology 2024Quote: VPg mutations D113G and R118H were introduced by site-directed mutagenesis in the p35STunos plasmid using the Quikchange II XL kit (Agilent Technologies, Santa Clara CA, USA) and following the indications of the manufacturer ...
-
bioRxiv - Genomics 2023Quote: ... we performed 6 cycles of PCR amplification on the remaining indexed DNA.The size distribution of the resulting library was monitored using a Fragment Analyzer with the High Sensitivity NGS kit (Agilent Technologies, Santa Clara, CA, USA) and the library was quantified using microfluorimetry (Qubit dsDNA HS kit ...
-
bioRxiv - Genomics 2023Quote: ... The size distribution of the resulting library was monitored using a Fragment Analyzer with the High Sensitivity NGS kit (Agilent Technologies, Santa Clara, CA, USA) and the library was quantified using the KAPA Library quantification kit (Roche ...
-
bioRxiv - Plant Biology 2023Quote: ... The quality of the total RNA extracted from target cells was evaluated using the RNA 6000 Pico kit on an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). RNA integrity was determined based on the RNA Integrity Number (RIN ...
-
bioRxiv - Cancer Biology 2023Quote: ... was used for inhibiting glycolysis (and associated ECAR) and was obtained from the Seahorse XF Glycolytic Rate Assay Kit (Agilent Technologies 103344-100. FCCP (5μM) was used to reveal maximal respiratory capacity (and associated OCR ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The library was quality controlled by analysis on an Agilent 2000 Bioanalyzer with the Agilent High Sensitivity DNA Kit (Agilent Technologies, Santa Clara, CA, USA) for fragment sizes of ca ...
-
bioRxiv - Cancer Biology 2022Quote: A library of the entire genomic sequence of all 50 known genes (electronic supplementary Table S1) was prepared using HaloPlex Target Enrichment kits (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA quantity and purity were determined using a NanoDrop™ spectrophotometer (ND-1000, ThermoScientific™, Delaware, USA) and an Agilent 2100 Bioanalyzer with the RNA 6000 Nano Kit (Agilent Technologies, CA, USA) using the 2100 Expert Software to calculate RNA Integrity Number (RIN ...
-
bioRxiv - Pathology 2023Quote: ... A mutant minigene with the c.1066-11G>A variant was generated by site-directed mutagenesis with QuikChange Lightning Kit (Agilent Technologies, Santa Clara, CA, USA). Sanger sequencing confirmed the identity of the constructs ...
-
bioRxiv - Microbiology 2024Quote: ... RNA quality and integrity were assessed via chip gel electrophoresis with a 2100 Bioanalyzer and an RNA Nano chip kit (Agilent Technologies, Santa Clara, CA, USA).
-
bioRxiv - Cancer Biology 2024Quote: ... Between 3 to 6 sections of each tumor were also immunostained for Ki67 (mouse anti-ki67, BD, San Jose CA, USA; blocking reagent, M.O.M ImmPRESS kit, Vector Laboratories, Burlingame CA, USA; liquid DAB+, Dako North America Inc, Carpinteria CA, USA), digitized (Nanozoomer ...
-
bioRxiv - Zoology 2024Quote: ... The quality and quantity of the libraries were checked on an Agilent 2100 Bioanalyzer using the Agilent DNF-935 Reagent Kit (Agilent Technologies, Santa Clara, CA, USA). Libraries were pooled to equimolar amounts ...
-
bioRxiv - Cancer Biology 2021Quote: 1×104 OE19 cells were reverse transfected with siRNAs and seeded into 96-well plates (Agilent, 102601-100). 24 hours post-transfection cells were treated with 500 nM lapatinib or vehicle control ...
-
bioRxiv - Cell Biology 2022Quote: ... Secondary antibodies used for immunoblotting were Horseradish Peroxidase (HRP)-conjugated swine anti-rabbit (DAKO, cat# P0399; 1:4,000) or goat anti-mouse (DAKO ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primary antibody was detected after probing for 1 hour with HRP-linked rabbit anti-mouse IgG (P0161, Dako) or goat anti-rabbit IgG (P0448 ...