Labshake search
Citations for Agilent :
6401 - 6450 of 8085 citations for Rat Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... RNA quality was checked using a 2100 Bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies, Santa Clara, CA, USA). DNA libraries suitable for sequencing were prepared from 10 ng of DNase-treated total RNA ...
-
bioRxiv - Immunology 2024Quote: Quantification of both the amplifications and libraries was performed using the Agilent Bioanalyzer High Sensitivity DNA assay (High-Sensitivity DNA Kit, Agilent) and KAPA Library Quantification Kit (Kapa biosynthesis) ...
-
bioRxiv - Neuroscience 2024Quote: ... The catalytic dead mutant PLCXD2- FLAG CD where histidine residues at position 57 and 132 were replaced with leucines was generated by in vitro mutagenesis using the QuikChange II Site-Directed Mutagenesis Kit (Agilent) from PLCXD2-FLAG ...
-
bioRxiv - Microbiology 2024Quote: ... Library quality was assessed using High Sensitivity D1000 kit on a 4200 TapeStation instrument (Agilent Technologies, Santa Clara, CA, USA). The NovaSeq Sequencing System (Illumina ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Final library quality was determined by Bioanalyzer 2100 using the Agilent High Sensitivity DNA Kit (Agilent, Cat. No. 5067-4626) and pooled together after normalizing samples based on their quantity from qPCR ...
-
bioRxiv - Plant Biology 2024Quote: ... RNA quantity and quality were determined using the Agilent RNA 6000 Pico Kit with Bioanalyzer 2100 system (Agilent Technologies, USA). Samples with high purity and RNA Integrity Number (RIN ...
-
bioRxiv - Plant Biology 2024Quote: ... and the quality of RNA based on the RNA Integrity Number was estimated using either the 2100 BioAnalyzer (Cat no: G2939BA; RNA 6000 Nano Kit; Cat no: 5067-1511. Agilent), 5200 Fragment Analyzer (Cat no ...
-
bioRxiv - Developmental Biology 2024Quote: ... Different phosphorylation state isoforms for phf10 mRNA were generated by site-directed mutagenesis using QuikChange Multi Site-Directed Mutagenesis kit (#200514, Agilent), following manufacturer’s instructions and specific primers (Supp ...
-
bioRxiv - Developmental Biology 2024Quote: Donor plasmid PAM sites were mutated using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). The gRNA-encoding plasmids pU6-BbsI-chiRNA-RhoGEF2 and pU6-BbsI-chiRNA-Cysts were made by insertion of gRNA oligos into pU6-BbsI-chiRNA (Addgene #45946 ...
-
bioRxiv - Genetics 2023Quote: ... ND-1000 UV-visible light spectrophotometer (Nanodrop Technologies) and Bioanalyzer 2100 with the RNA 6000 Nano Lab Chip kit (Agilent) was used to assess the concentration and integrity of RNA.
-
bioRxiv - Microbiology 2024Quote: ... The integrity of the RNAs was verified using the Agilent 2100 bioanalyzer with the RNA 6000 Nano kit (Agilent Technologies). RT-pPCR experiments and data analysis were performed as described (19) ...
-
bioRxiv - Biochemistry 2024Quote: The expression vector encoding His-tagged SpNOXDH - aa 181-417 of full-length SpNOX - was obtained from SpNOX by site-directed mutagenesis according to the manufacturer’s protocol (QuikChange® Lightning Site-Directed Mutagenesis Kit, Agilent), using forward primer 5’GTCTGGTCCCGCGTGGCAGTAAAATTAGCTTTCCGTATCTGGG3’ and reverse primer 5’CCCAGATACGGAAAGCTAATTTTACTGCCACGCGGGACCAGAC3’ ...
-
bioRxiv - Molecular Biology 2024Quote: The CtIP-S276A variant was prepared by mutating the respective wild-type pFB-2xMBP-CtIP-10xhis plasmid by QuickChange site-directed mutagenesis kit following manufacturer’s instructions (Agilent Technology). The wild-type protein ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then single indexed libraries were prepared using Agilent Sure-Select methodology (XT-HS kit, Agilent, Santa Clara, CA, US). The libraries (some pooled ...
-
bioRxiv - Immunology 2024Quote: ... The libraries were analyzed for size distribution and concentration using BioAnalyzer High Sensitivity DNA kit (Agilent Technologies, Santa Clara, CA). Libraries were pooled at equimolar concentrations and sequenced on Novaseq6000 (Illumina ...
-
bioRxiv - Biophysics 2021Quote: ... cells were resuspended in 200 μL PBS containing 1% BSA for detection by NovoCyte (Agilent) utilizing laser excitation and emission wavelengths of 488 nm and 530 nm ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells that were kept in GM were washed and incubated in XF Base Medium (Agilent) containing 1 mM sodium pyruvate ...
-
bioRxiv - Neuroscience 2022Quote: ... the plasmid was amplified using chemically competent cells deficient for recombinase activity (Agilent Technologies #200152), purified (Macherey-Nagel #740416.10) ...
-
bioRxiv - Immunology 2021Quote: ... Cells were washed and analyzed by flow cytometry (NovoCyte Flow Cytometer Systems, Agilent, CA, USA). The tetramer positive staining wells were pooled and CD8/Tetramer double positive population were sorted using flow cytometric sorting (ARIA II sorter ...
-
bioRxiv - Genomics 2019Quote: ... Recombinant PA-Tnp protein was expressed in BL21-Gold(DE3) competent cells (Agilent cat # 230132) and purified using nickel beads ...
-
bioRxiv - Developmental Biology 2019Quote: ... cell culture medium was replaced with the appropriate pre-warmed Seahorse XF Base Medium (Agilent Biotechnology ...
-
bioRxiv - Immunology 2019Quote: Cell culture supernatants were harvested and concentrated with StrataClean resin beads (Agilent Technologies, CA, USA), as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: The pHMT-KTN1 plasmid was transformed into BL21-CodonPlus (DE3)-RIPL competent cells (Agilent Technologies). Protein was affinity-purified using Ni-NTA agarose (Qiagen #301210) ...
-
bioRxiv - Immunology 2021Quote: ... Cells were washed and analyzed by flow cytometry (NovoCyte Flow Cytometer Systems, Agilent, CA, USA). The tetramer positive staining wells were pooled and CD8/Tetramer double positive population were sorted using flow cytometric sorting (ARIA II sorter ...
-
bioRxiv - Biochemistry 2021Quote: ... Expression vectors containing gene of interest were transformed into BL21-Gold (DE3) competent cells (Agilent) and the cells were cultured to a density of ~1 OD600/ml at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... Barcoded single cell capture plates were prepared with a Bravo automated liquid handling platform (Agilent) as described previously28 ...
-
bioRxiv - Neuroscience 2020Quote: ... Washing procedure was repeated and cells were coversliped using an aqueous fluorescent mounting medium (Dako). The specimens were analysed under a confocal microscope Leica TCS SP8 (Leica Microsystems ...
-
bioRxiv - Neuroscience 2020Quote: Mitochondrial function was assessed using a Seahorse XF24 cell MitoStress Test (Agilent Technologies, California, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Pt cones and an Octopole Reaction System (ORS) collision cell (Agilent Technologies, Santa Clara, CA). The data was collected using a 3-point peak pattern ...
-
bioRxiv - Cell Biology 2020Quote: ... Barcoded single cell capture plates were prepared with a Bravo automated liquid handling platform (Agilent) as described previously16 ...
-
bioRxiv - Biophysics 2020Quote: The hSirt3102-399 was expressed in E.coli Arctic Express (DE3) cells (Agilent Technologies, Wilmington, DE) as per manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2022Quote: ... pAAV plasmids were co-transfected with a pDP6 helper plasmid into HEK293-AAV cells (Agilent). Cells were lysed 72 h after transfection and viral particles were purified using Iodixanol gradient followed by separation ion-exchange chromatography (GE Healthcare) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The single cell libraries were assessed for quality (TapeStation 4200, Agilent, Santa Clara, CA, USA) and then run by using paired-end 50 bp sequencing on the Illumina HiSeq 4000 platform (Illumina ...
-
bioRxiv - Immunology 2022Quote: ... The cells were fixed with 100 ml chilled methanol and incubated with Peroxidase Block (Dako) followed by mouse anti-CMV IE-1/IE2 mAb (Chemicon ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were then antibody stained with guinea-pig anti insulin (1:500, Dako, Carpinteria, CA), Alexa Fluor 647 anti guinea-pig (1:1000 Thermo Fisher ...
-
bioRxiv - Biophysics 2022Quote: ... at a density of 16.000 cells per well using the liquid handler BRAVO from Agilent equipped with a 96-LT (Large Tips ...
-
bioRxiv - Biochemistry 2022Quote: ... Peptides were expressed in BL21-Codon Plus (DE3) RIPL cells (Agilent, Santa Clara, CA, USA) in ZYP-5052 auto-induction media(Studier ...
-
bioRxiv - Biochemistry 2021Quote: ... All AtAtm3 constructs were overexpressed in Escherichia coli BL21-gold (DE3) cells (Agilent Technologies, CA) using ZYM-5052 autoinduction media as described previously (Fan et al. ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: OCR in human liver cells was measured using XFp Extracellular Flux Analyzers (Agilent Seahorse Biosciences). The cells were plated into XFp cell culture mini plates for 24 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... The Seahorse XF Cell Mito Stress test was performed on a Seahorse XFe96 Analyzer (Agilent) in the XF Base Medium (Agilent ...
-
bioRxiv - Physiology 2022Quote: ... Tubulointerstitial cell proliferation was detected by a monoclonal mouse anti-PCNA antibody (Dako, Glostrup, Denmark), while collagen I and fibronectin positivity were detected with polyclonal anti-collagen I (Rockland Immunochemicals ...
-
bioRxiv - Plant Biology 2019Quote: ... the pET21 plasmid containing PL1 was transformed into BL21 DE3 pLyS cells (Agilent, Edinburgh, UK). PL1 expression was induced at mid-log phase by supplementing the media with 0.3 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were resuspended in 200 μL PBS containing 1% BSA for detection by NovoCyte (Agilent) utilizing laser excitation and emission wavelengths of 488 nm and 530 nm ...
-
bioRxiv - Biochemistry 2020Quote: ... coli cells by the heat-shock approach as described in the supplier’s manual (Novagen/Agilent) and by antibiotic selection using Zeocin (Invitrogen/ThermoFisher) ...
-
bioRxiv - Immunology 2020Quote: ... cells were barcoded using automated liquid handling robotic system (Agilent Technologies, Santa Clara, CA, USA)(38 ...
-
bioRxiv - Immunology 2021Quote: ... 1.5 x 105 cells per well were seeded into seahorse culture plate (Agilent, 102416-100) precoated with Cell-Tak (Corning ...
-
bioRxiv - Biochemistry 2020Quote: ... The hSirt3,102-399 was expressed in E.coli Arctic Express (DE3) cells (Agilent Technologies, Wilmington, DE) as per manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2021Quote: ... cell culture media was washed and replaced with fresh assay media (XF basic media; Agilent), supplemented with 10 mM Glucose ...
-
bioRxiv - Genetics 2019Quote: ... The PCR product was ligated with T4 ligase prior to transformation into competent cells (Stratagene). The plasmid was sequenced to validate the removal of the putative EGR1 binding site ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV8- GFAP-OptoA1-eYFP was produced by standard triple transfection of AAV 293 cells (Agilent). At 72 h post-transfection ...