Labshake search
Citations for Agilent :
6651 - 6700 of 8085 citations for Rat Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... The phosphomimetic T14E mutation and the LE mutation on syntaxin-3b were also generated using QuickChange Kit (Agilent, Santa Clara, CA). Full-length SNAP-25 and the cytoplasmic domain of synaptobrevin-2 (residues 1–96 ...
-
bioRxiv - Immunology 2020Quote: ... The recombinant Ad5 genomes with HA inserts were linearized with PacI and buffer exchanged using a Strataprep PCR purification kit (Agilent Technologies). The linearized recombinant gDNA was transfected into 293 cells using the PolyFect Transfection Reagent (Qiagen) ...
-
bioRxiv - Molecular Biology 2020Quote: The plasmid pUHD-FLAG-H3.3K56R and pUHD-FLAG-H3.3K56Q were constructed using a Quick Change II Site-Directed Mutagenesis Kit (Agilent, CA, United States), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... The RM19R Fab heavy chain plasmid was made introducing two stop codons following residue D234 in the RM19R IgG1 heavy chain vector using the QuikChange® Lightning Site-Directed Mutagenesis kit (Agilent). The RM19R Fab was expressed in HEK293F cells (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quality control of obtained libraries was done using Agilent Bioanalyzer with High Sensitivity DNA Kit (Agilent Technologies, Palo Alto, CA, USA). Quantification of the libraries was done using Quantus Fluorometer and QuantiFluor Double Stranded DNA System (Promega ...
-
bioRxiv - Biophysics 2021Quote: ... Nucleotide substitutions associated with NS or leukemia were introduced by site-directed mutagenesis (QuikChange site-directed mutagenesis kit; Stratagene, CA, USA). A construct containing the cDNA encoding the isolated PTP domain preceded by the C-SH2 domain (residues 105-528 ...
-
bioRxiv - Cancer Biology 2021Quote: ... were constructed using TSC2-SATA as the template for site-directed mutagenesis and the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Technologies). The sequences of all point mutations were verified by Sanger sequencing.
-
bioRxiv - Molecular Biology 2022Quote: ... Site-directed mutagenesis was carried out according to the instructions accompanying the Quik-Change® Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene). The principal vector used for most A ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified RNA was quantified using a Bioanalyzer and the Agilent RNA 6000 Pico kit (5067-1513, Agilent, Santa Clara, CA, USA). miRNA libraries were prepared from the isolated EV RNA and a water control using the TruSeq Small RNA Library Preparation Kit (RS-200-0012 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pSV-S515D-AR plasmids were synthesised from the pSV-AR template using the QuikChange Lightning Multi Site-directed mutagenesis kit (Agilent Technologies). Mutations were introduced using the following primers ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were visualized using the Agilent Fragment Analyzer instrument and the HS NGS Fragment Kit (Agilent Technologies Inc., Santa Clara, CA). Forty-eight libraries were pooled at approximately equal molarity and sequenced (200 pM final loading concentration ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Genomics 2022Quote: ... the SureSelect XT Mouse Methyl-Seq Kit Enrichment System for Illumina Multiplexed Sequencing Library protocol (Agilent Technologies, version E0, April 2018) was used as described before (34) ...
-
bioRxiv - Genomics 2022Quote: ... and T7-Mutagenesis-primer-F and T7-Mutagenesis-primer-R to replace the “G” following the T7 promoter sequence with an “A” by the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, 210518). T7-5’UTR fragment was PCR-synthesized using the mutagenesis-modified pcDNA3.3-eGFP and T7-5’UTR-primer-F and T7-5’UTR-primer-R ...
-
bioRxiv - Genetics 2022Quote: ... Site directed mutagenesis was carried out according to the instructions accompanying the Quik-Change® Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene). The principal vector used for most A ...
-
bioRxiv - Cancer Biology 2022Quote: ... K277Q or K277R directed mutagenesis was performed on this vector using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521), following manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... RNA quality and concentration were measured using an Agilent 2100 Bioanalyzer and the Agilent Nano Eukaryotic RNA Kit (Agilent, #5067-1511). All bioanalyzer assays were performed by the Stanford Protein and Nucleic Acid Facility.
-
bioRxiv - Physiology 2022Quote: ... The concentration and quality of the library were measured using the Agilent 2100 Bioanalyzer and Agilent’s High Sensitivity DNA Kit (Agilent, #5067-4626) by the Stanford Protein and Nucleic Acid Facility.
-
bioRxiv - Physiology 2022Quote: ... The concentration and quality of the amplified cDNA library were measured using the Agilent 2100 Bioanalyzer and Agilent’s High Sensitivity DNA Kit (Agilent, #5067-4626) by the Stanford Protein and Nucleic Acid Facility.
-
bioRxiv - Physiology 2022Quote: ... The glycolytic function metrics was calculated by Seahorse Wave Desktop Software as directed in the glycolysis stress kit manual (Agilent Technologies).
-
bioRxiv - Microbiology 2019Quote: Site-directed mutagenesis was carried out using a QuikChange II Site-Directed Mutagenesis Kit (Stratagene, Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: Trio WES of 13 patients and their parents was performed using the SureSelect Human All Exon V5+UTR kit (Agilent technologies). In patient 4 ...
-
bioRxiv - Neuroscience 2019Quote: ... pCMV-Tag-3B-2XMyc-LRRK2-D1994A was generated by mutagenesis of pCMV-Tag-3B-2XMyc-LRRK2-WT using a QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... The quantity of the bacterial RNA samples was measured on a NanoDrop ND1000 system and their quality analyzed on the Agilent 2100 Bioanalyzer system with the Agilent RNA 6000 Nano kit protocol (Agilent Technologies), according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... RNA quantification was performed using Qubit and Nanodrop 2000 and quality of the RNA was determined by the Bioanalyzer RNA 6000 Nano Kit (Agilent Technologies) for 10 random samples ...
-
bioRxiv - Plant Biology 2019Quote: ... The exact point mutations for each of the three Hsf1 missense mutations were engineered into the cDNA of ZmHK1 in the plasmid P415-CYC1-ZmHK1 plasmid with the QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) using the manufacturer’s specifications.
-
bioRxiv - Pathology 2019Quote: ... Pathogenic mutations and variations in the INF2 sequence were introduced by a PCR-based mutagenesis (Cat No: 200523, QuickChange II Site-Directed Mutagenesis kit, Agilent Technologies). To achieve stable expression of fragments in human podocytes ...
-
bioRxiv - Biochemistry 2019Quote: ... hhp1 and hhp2 mutants were created by mutagenizing pIRT2 plasmids containing hhp1+ and hhp2+ using a QuikChange site-directed mutagenesis kit (Agilent Technologies). For protein production ...
-
bioRxiv - Pathology 2020Quote: ... Mutations required for domain excision and/or punctual changes within P1 nucleotidic sequence were introduced in the P1 open reading frame using the QuikChange® II XL Site-Directed mutagenesis kit (Agilent-Stratagene) and related primers (Appendix Table 1) ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Genetics 2019Quote: ... Site directed mutagenesis was carried out according to the instructions accompanying the Quik-Change® Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene). The principal vector used for UapA mutants was pAN510-GFP carrying a gfp-tagged uapA gene ...
-
bioRxiv - Cell Biology 2019Quote: ... hFN10 containing a TAG stop codon at position 1493 was generated by PCR-based mutagenesis with the Quick-change kit (Agilent Technologies), cloned into bacterial expression plasmid pET11a and verified by DNA sequencing ...
-
bioRxiv - Cancer Biology 2019Quote: ... according to the manufacturer protocol and purity as well as integrity controlled using the Agilent RNA 6000 nano kit (Agilent Technologies). RNA sequencing was performed on an Illumina NextSeq500™ platform ...
-
bioRxiv - Cancer Biology 2019Quote: ... Single-cell RNA-seq libraries were prepared according to the manufacturer’s protocol and the library quality was confirmed with a Bioanalyzer High-Sensitivity DNA Kit (Agilent, 5067-4627) and a Qubit dsDNA HS Assay Kit (ThermoFisher ...
-
bioRxiv - Molecular Biology 2019Quote: ... Site directed mutagenesis was carried out according to the instructions accompanying the Quik-Change® Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene). The principal vector used for most A ...
-
bioRxiv - Microbiology 2019Quote: ... 39) with primers WNTP0548 (GAGTTATTGGGGGCTTGAAGT) and WNTP0549 (AATCCTTTTTCGATGTTGATAATTAAGTCG) and subjected to random mutagenesis using GeneMorph II EZClone Mutagenesis kit (Agilent Technologies) per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... pGEX(M)_cstK derivatives harboring different mutations were generated by using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA), and resulted in the construction of plasmids detailed in Table 2 ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... The quantity and purity of the total RNA were measured using a Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (RIN>7.0; Agilent, CA, USA). Poly(A ...
-
bioRxiv - Genomics 2019Quote: Paired-end DNA sequencing libraries of 28 individuals were generated using Aglilent SureSelect Human All ExonV6 kit (Agilent Technologies, CA, USA) by Novogene Co. ...
-
bioRxiv - Cell Biology 2019Quote: ... the total RNA from each sample was amplified and labeled by using a Low Input Quick Amp WT Labeling kit (Agilent Technologies). Labeled cRNA was purified using an RNeasy Mini kit (Qiagen GmbH) ...
-
bioRxiv - Developmental Biology 2020Quote: ... p10UAST-Robo1-MYC and the p5UAST-HA-Robo1 constructs were subcloned into the smaller pBlueScript backbone and point mutations were introduced into the WIRS motif of the Robo coding sequences with the Quikchange II site-directed mutagenesis kit (Agilent, #200523) using the following primers ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The error-prone library of the initial hit of the ACE2 helix scaffolded design was constructed by error-prone PCR with a GeneMorph II Random Mutagenesis Kit (Agilent Technologies) with manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The human M280L mutation in FOXR1 was generated by introducing a point mutation at residue 280 (methionine to leucine) using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) in the pSport6 human FOXR1 plasmid with the following forward 5’-CCAACAGTGCTTGAGCCAGCCAG-3’ and reverse 5’-ATACTTTCTAGCCGAGTGGAAG-3’ primers and verified by nucleotide sequencing ...
-
bioRxiv - Physiology 2019Quote: ... The total RNA quantity and purity were determined by a Bioanalyzer 2100 and RNA 1000 Nano LabChip Kit (Agilent, CA, USA) and samples with an RNA integrity number (RIN ...
-
bioRxiv - Biophysics 2020Quote: ... The VDAC1 mutations at serine 215 to glutamate (S215E) was generated by PCR with QuikChange site-directed mutagenesis kit (Agilent Technology) using pET-VDAC1 as cDNA templates and the following primers ...
-
bioRxiv - Genetics 2020Quote: ... serial sections were stained singly with antibodies against BCL6 and CD8 and a DAB DAB visualization kit (Envision Double Stain system, Dako; USA) for bright field microscopy ...
-
bioRxiv - Systems Biology 2020Quote: ... Immunohistochemical staining was obtained performed using a biotinylated-streptovidin-peroxidase complex (Dako Universal LSAB™+ Kit/HRP-K0690, Dako, Glostrup, Denmark) with DAB (3,3-Diaminobenzidin)-chromogen (Dako-K3468 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Site-specific mutation of K674R was introduced in pQCXIP-FLAG-MD by using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The quality of the remaining RNA was checked using a Bioanalyzer RNA 6000 Nano Kit (Agilent Technologies, Santa Clara, CA, USA) (all RIN values > 9 ...
-
bioRxiv - Zoology 2020Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA).