Labshake search
Citations for Agilent :
6301 - 6350 of 7040 citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Enzymatically-dead zDHHC3 mutant transgenic mice overexpressing zDHHC3DHHS in cardiomyocytes were generated by site-directed mutagenesis of the α-MHC-Zdhhc3 promoter-transgene construct using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to encode a mutation of Cys-157 in mouse zDHHC3 protein to Ser ...
-
bioRxiv - Molecular Biology 2020Quote: ... integrity and the amount of total RNA were measured with a ‘Bioanalyzer 2100’ using an ‘RNA Nano 6000 Microfluidics Kit’ (both Agilent genomics). RNA labeling was performed with the two color ‘Quick Amp Labeling Kit’ (Agilent genomics ...
-
bioRxiv - Neuroscience 2021Quote: ... The quality of the libraries is determined using the Standard High sensitivity NGS Fragment analysis kit (DNF-474, 1-6000 base pair) on the Agilent Fragment analyzer (Agilent, USA), yielding approximately 260 bp size fragments ...
-
bioRxiv - Microbiology 2021Quote: ... The MPER changes (L669S, W672A, I675A, T676A and L679A) were introduced using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies). All the mutations were confirmed by DNA sequencing ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA extracted from FACS isolated cells was quantified and assessed for quality using the RNA 6000 Pico Kit (Agilent – 5067-1513) and an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Developmental Biology 2020Quote: ... Post cDNA amplification and post library construction quality control was performed using the Agilent Bioanalyzer High Sensitivity kit (Agilent 5067-4626). Libraries were sequenced using a NovaSeq 6000 and the S2 flow cell ...
-
bioRxiv - Cell Biology 2021Quote: ... Fluorescent-based assays including qPCR with the Universal KAPA Library Quantification Kit and Fragment Analyzer (Advanced Analytics) or BioAnalyzer (Agilent 2100) were used to evaluate final libraries ...
-
bioRxiv - Genomics 2021Quote: ... and quality was determined with a DNA ScreenTape Kit on the TapeStation 2200 system (Agilent, 5067-5582, 5067-5583, 5067-5586). Paired end sequencing was done using a HiSeq 2500 (Illumina) ...
-
bioRxiv - Cancer Biology 2021Quote: Whole RNA was extracted from three replicates for each of the cell-lines followed by a quality assessment using Agilent Bioanalyser-2100 with Agilent nano Kit (Agilent Technologies). For each sample ...
-
bioRxiv - Microbiology 2022Quote: ... and the quality and quantity of ds-cDNA was determined with NanoDrop 1000 and a 2100 Bioanalyzer using the Agilent DNA 7500 kit (Agilent Technologies). Four hundred ng of total RNA yielded on average 12 μg of ds-cDNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a p72Plk3 point mutant (Plk3R354G) was generated via site-directed mutagenesis using a QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies). All mutants were subcloned into the pCMV-Tag2A vector ...
-
bioRxiv - Cell Biology 2022Quote: ... ASNA-1A63V::GFP was generated by mutagenesis of pVB222GK (Kao et al., 2007) to introduce the A63V change using the QuickChange II Kit (Agilent Technologies). The resulting plasmid (pGK200 ...
-
bioRxiv - Microbiology 2022Quote: ... ΔNef ANCH3 (HIV-1 ANCH3 IND116A) was obtained by insertional mutagenesis using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent #200522), for integrase (IN ...
-
bioRxiv - Molecular Biology 2022Quote: ... The quality of the prepared libraries was assessed using an Agilent 2100 bioanalyzer and a High Sensitivity DNA kit (Agilent Technologies), or Fragment Analyzer and dsDNA 915 Reagent Kit (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were purified and quantified using the dsDNA Fluorescence Quantification Assays (DeNovix) and fragment sizes were assessed with the BioAnalyzer High Sensitivity DNA Kit (Agilent Technologies). The libraries were sequenced on an Illumina NextSeq 500 ...
-
bioRxiv - Biochemistry 2022Quote: ... Point mutations (I91F and K176E) were introduced using the QuickChange II XL Site-Directed Mutagenesis Kit (SI Table 1; Agilent Technologies). The full-length sequence of the PAI-1 constructs was confirmed by Sanger sequencing (SI Table 1) ...
-
bioRxiv - Biophysics 2022Quote: ... point mutations were introduced to cDNA by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Inc.) and PrimeSTAR Max DNA Polymerase (Takara Bio Inc. ...
-
bioRxiv - Genetics 2022Quote: To introduce the T1035S or R1147W mutations we used the QuikChange II XL Multi Site-Directed Mutagenesis kit (Agilent Technologies, #200521). The primers for the single mutagenesis experiments were designed by QuikChange software (Stratagene ...
-
bioRxiv - Biophysics 2022Quote: ... PPARγ2 mutants were generated by nucleotide substitution using the QuikChange II XL Site Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... All the mutants used in these cellular assays were generated by using QuikChange II-E Site-Directed Mutagenesis Kit (#200555, Agilent Technologies).
-
bioRxiv - Developmental Biology 2022Quote: ... product size distribution and quantity were assessed on a Bioanalyzer using an Agilent 2100 high-sensitivity DNA assay kit (5067-4626, Agilent Technologies). The library preparation (KAPA Hyper Plus Library prep kit ...
-
bioRxiv - Cell Biology 2022Quote: ... c-Src cloned in pBluescript SK+ vector through BamHI and XbaI sites was mutated using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) with the forward primer (5’-CCACTTTCGTGGCTCTCGAGGACTACGAGTCCCGGACTG-3’ ...
-
bioRxiv - Cell Biology 2022Quote: Glycolysis stress kit was used to study acute ECAR change upon TNFα stimulation using a seahorse eXF96 extracellular flux analyzer (Seahorse Bioscience). HLMVECs were seeded in an XF96 cell plates at 25,000 cells/well for analysis the following day ...
-
bioRxiv - Genomics 2022Quote: ... RNA integrity was assessed with the RNA nano 6000 assay kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA). In molluscs ...
-
bioRxiv - Genomics 2022Quote: ... The final size of ∼250 bp was assessed using a Fragment Analyzer genomic DNA analysis Kit (Agilent Technologies, Santa Clara, CA). For library preparation ...
-
bioRxiv - Immunology 2022Quote: ... the cDNA was evaluated for size distribution and quantity using the Fragment Analyzer High Sensitivity NGS Fragment Analysis Kit (Agilent Technologies) and the Qubit dsDNA HS Assay Kit (ThermoFisher ...
-
bioRxiv - Genetics 2022Quote: ... 2014) bearing FRQ point mutations to restriction-digested pCB05 in place of the QuickChange II® Site-directed Mutagenesis Kit (Stratagene). Four primer sets were used as flanks to facilitate homologous recombination in a yeast strain (FY834 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Deletion of putative TF binding sites from those enhancers were performed using QuickChange II XL site-directed mutagenesis kit (Agilent Technologies). All constructs were confirmed by Sanger Sequencing (Quintara Biosciences) ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were individually cleaned-up with 0.9 volumes of sample purification beads and concentration and size distributions were measured by Qubit™ dsDNA high sensitivity kit and by Agilent 2100 Bioanalyzer with the Agilent high sensitivity DNA kit ...
-
bioRxiv - Genomics 2022Quote: ... Amplified products were purified with the Zymo Research DNA Clean & Concentrator-5 kit and then analyzed for concentration and size distribution with a HSD5000 screentape (Agilent, #5067) on an Agilent 4150 TapeStation system ...
-
bioRxiv - Microbiology 2022Quote: ... hepaticus versus the tdTomato fluorescent protein (72 h transduction) was quantified in epithelial intestinal HT-29 cells using the Human GE 4x44K v2 Microarray Kit (Agilent Technologies) as we previously detailed [13 ...
-
bioRxiv - Pathology 2022Quote: Total RNA quantity and quality were assayed with an Agilent 2100 bioanalyzer instrument using the RNA 6000 Nano kit (Agilent Technologies). Libraries were prepared at Next Generation Sequencing Core at the University of Pennsylvania using TruSeq Stranded mRNA HT Sample Prep Kit (Illumina ...
-
bioRxiv - Plant Biology 2022Quote: ... The quality of the libraries was assessed using the Agilent 2100 High Sensitivity DNA Kit (Agilent Technologies, Santa Clara, CA, USA) and subjected to paired-end sequencing on the Illumina HiSeq 2500 platform (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... Yield of input and immunoprecipitate were independently quantified using a Bioanalyzer (Agilent RNA 6000 Pico Kit; Agilent Technologies, Santa Clara, USA) and Quant-IT RiboGreen Kit (ThermoFisher Scientific Inc. ...
-
bioRxiv - Molecular Biology 2023Quote: ... after which the RNA integrity number (RIN) was measured with Agilent 2100 Bioanalyzer using RNA 6000 Nano kit (Agilent, #5067-1511). All samples had RIN >9 ...
-
bioRxiv - Neuroscience 2022Quote: Small RNA and miRNA RNA quantity and quality in the nine EV samples were assessed by capillary electrophoresis in the 2100 Bioanalyzer and the Agilent Small RNA kit (Agilent Technologies). miRNA libraries were generated with the NEXTFLEX Small RNA Sequencing Kit v3 (©Bioo Scientific Corp. ...
-
bioRxiv - Microbiology 2023Quote: ... Point mutations were generated by site-directed mutagenesis according to the instruction manual of the QuikChange® mutagenesis kit (Agilent Technologies).
-
bioRxiv - Plant Biology 2023Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA). A total amount of 1.5 μg RNA per sample was used as input material for the RNA sample preparations ...
-
bioRxiv - Neuroscience 2022Quote: ... was determined in primary astrocytes by measuring ECAR under basal conditions and in response to 0.5μM/0.5μM rotenone/antimycin A and 50 mM 2-deoxyglucose (2-DG) (all XFp Glycolytic Rate Assay Kit, Agilent Technologies, 103346-100) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... And RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). The library fragments (370 ~ 420 bp in length ...
-
bioRxiv - Plant Biology 2022Quote: ... The cDNA libraries were barcoded individually and analyzed for quantity and quality with the High Sensitivity DNA Analysis Kit in the Agilent 2100 Bioanalyzer (Agilent, USA). cDNA libraries were pooled in equal amounts for sequencing (single end ...
-
bioRxiv - Microbiology 2022Quote: ... were generated by site directed mutagenesis on HA-NOD2 plasmid (a gift from Dana Philpott) using the QuickChange II Site-Directed Mutagenesis kit (Agilent Technologies) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Residues 811-825 in the Mtb RNAP β flap were deleted using Quick Change II XL site-directed mutagenesis kit (Agilent). Variants of the wild type sigAP and sigAP”ext-10” (harboring the T-17G-16T-15G-14 motif ...
-
bioRxiv - Neuroscience 2022Quote: ... and L454A (or MA4-WRLAAA) were generated using appropriate primers and the QuikChange II XL Site-Directed Mutagenesis kit (Agilent Technologies) and were confirmed by DNA sequencing ...
-
bioRxiv - Neuroscience 2022Quote: ... the following primers were used to mutate the WIRS motif in the pcDNA3-DCCWT-HA construct using the Quikchange II site-directed mutagenesis kit (Agilent, #200523): CAACTCACCCACTCCGCGCCGCTGCTAATCCTTTGCTACC and GGTAGCAAAGGATTAGCAGCGGCGCGGAGTGGGTGAGTTG ...
-
bioRxiv - Neuroscience 2022Quote: ... and the p5xUAST-Fra-Myc constructs were subcloned into the smaller pBlueScript backbone and point mutations were introduced into the WIRS motif of the Fra coding sequences with the Quikchange II site-directed mutagenesis kit (Agilent, #200523) using the following primers ...
-
bioRxiv - Bioengineering 2022Quote: ... and the size distribution was confirmed using a High Sensitivity DNA Kit for Bioanalyzer (Agilent Technologies, Cat. No. / ID: 5067-4626). Libraries were sequenced on an Illumina NextSeq2000 in paired end mode with the read length of 50 nt and sequencing depth of 20 million reads per library ...
-
bioRxiv - Microbiology 2022Quote: ... on a Qubit Fluorometer (invitrogen) and fragment length was assessed with an Agilent 2100 Bioanalyzer (Agilent High sensitivity DNA Kit, Agilent). Samples were equimolarly pooled and sequenced on NextSeq™ 500 High Output Kit v2.5 (75 cycles ...
-
bioRxiv - Physiology 2024Quote: ... Sample integrity was assessed prior to library preparation using the Bioanalyzer 2110 system with an RNA Nano 6000 Assay Kit (Agilent Technologies). One hundred fifty-base paired-end sequencing was performed using an Illumina NovaSeq platform according to manufacture instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit for the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA). RNA samples were stored at -80 °C until being sent for sequencing.