Labshake search
Citations for Agilent :
6201 - 6250 of 7040 citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... SDM was carried out with appropriate primers (Table 4) using QuikChange® Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) according to manufacturer’s instruction.
-
bioRxiv - Microbiology 2020Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA). A total amount of 1 μg RNA per sample was used as input material for RNA sample preparations ...
-
bioRxiv - Immunology 2021Quote: ... The D614G amino acid change was introduced into VRC7480 by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit (catalog number 210518, Agilent Technologies). The mutation was confirmed by full-length spike gene sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... 96 libraries were generated and their profiles were analyzed using the BioAnalyzer 2100 with a High-Sensitivity DNA kit (Agilent, USA). To ensure the evenness of library pooling ...
-
bioRxiv - Microbiology 2021Quote: ... The enzymatically-inactive pCAGGS-TMPRSS2(S441A)FLAG mutant cDNA was generated using QuickChange Site-Directed Mutagenesis Kit per manufacturer instructions (Agilent Technologies). Transient transfections of HEK-293T cells were performed using PolyFect transfection reagent per manufacturer instructions (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: Site directed mutagenesis for Cys238>Ala active site substitution in scpA was performed using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) using oligonucleotides MP_scpA1 and MP_scpA2 [49].
-
bioRxiv - Neuroscience 2020Quote: ... The RNA was quantified with a Nanodrop 1000 spectrophotometer and its integrity checked with the Bionalyzer (Agilent RNA 6000 nano kit). RT-qPCR ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA concentration and purity were assessed using NanoDrop ND-1000 spectral photometer (Peqlab) and the quality of the RNA was determined using RNA 6000 Nano LabChip Kits (Agilent Technologies) on a 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA integrity was assessed with the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, Waldbronn, Germany) and the RNA integrity number (RIN ...
-
bioRxiv - Cell Biology 2021Quote: ... they were prepared and assayed for mitochondrial function assessment according to manufacturer instructions (Seahorse XF Cell Mito Stress Test Kit, Agilent Technologies). More details are found in Supplemental Methods.
-
bioRxiv - Microbiology 2021Quote: ... The RNA integrity number and library insert size were verified using the Agilent RNA 6000 Pico Kit and Bioanalyzer platform (Agilent, USA). The RiboZero (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... encoding the SAMHD1 mutant NLS (mNLS) and the P275A mutants were generated using a QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) according to the manufacturer’s protocol using the following primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and pDH15-42 were derived from the low copy number (lc) LEU2 PRT1 plasmid p5188 by site-directed mutagenesis of PRT1 using the QuickChange XL kit (Agilent Technologies) and the corresponding primers in Table S2 ...
-
bioRxiv - Neuroscience 2021Quote: ... The phosphomimetic T14E mutation and the LE mutation on syntaxin-3b were also generated using QuickChange Kit (Agilent, Santa Clara, CA). Full-length SNAP-25 and the cytoplasmic domain of synaptobrevin-2 (residues 1–96 ...
-
bioRxiv - Molecular Biology 2020Quote: The plasmid pUHD-FLAG-H3.3K56R and pUHD-FLAG-H3.3K56Q were constructed using a Quick Change II Site-Directed Mutagenesis Kit (Agilent, CA, United States), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... The RM19R Fab heavy chain plasmid was made introducing two stop codons following residue D234 in the RM19R IgG1 heavy chain vector using the QuikChange® Lightning Site-Directed Mutagenesis kit (Agilent). The RM19R Fab was expressed in HEK293F cells (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quality control of obtained libraries was done using Agilent Bioanalyzer with High Sensitivity DNA Kit (Agilent Technologies, Palo Alto, CA, USA). Quantification of the libraries was done using Quantus Fluorometer and QuantiFluor Double Stranded DNA System (Promega ...
-
bioRxiv - Biophysics 2021Quote: ... Nucleotide substitutions associated with NS or leukemia were introduced by site-directed mutagenesis (QuikChange site-directed mutagenesis kit; Stratagene, CA, USA). A construct containing the cDNA encoding the isolated PTP domain preceded by the C-SH2 domain (residues 105-528 ...
-
bioRxiv - Cancer Biology 2021Quote: ... were constructed using TSC2-SATA as the template for site-directed mutagenesis and the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Technologies). The sequences of all point mutations were verified by Sanger sequencing.
-
bioRxiv - Molecular Biology 2022Quote: ... Site-directed mutagenesis was carried out according to the instructions accompanying the Quik-Change® Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene). The principal vector used for most A ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified RNA was quantified using a Bioanalyzer and the Agilent RNA 6000 Pico kit (5067-1513, Agilent, Santa Clara, CA, USA). miRNA libraries were prepared from the isolated EV RNA and a water control using the TruSeq Small RNA Library Preparation Kit (RS-200-0012 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pSV-S515D-AR plasmids were synthesised from the pSV-AR template using the QuikChange Lightning Multi Site-directed mutagenesis kit (Agilent Technologies). Mutations were introduced using the following primers ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were visualized using the Agilent Fragment Analyzer instrument and the HS NGS Fragment Kit (Agilent Technologies Inc., Santa Clara, CA). Forty-eight libraries were pooled at approximately equal molarity and sequenced (200 pM final loading concentration ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Genomics 2022Quote: ... the SureSelect XT Mouse Methyl-Seq Kit Enrichment System for Illumina Multiplexed Sequencing Library protocol (Agilent Technologies, version E0, April 2018) was used as described before (34) ...
-
bioRxiv - Genomics 2022Quote: ... and T7-Mutagenesis-primer-F and T7-Mutagenesis-primer-R to replace the “G” following the T7 promoter sequence with an “A” by the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, 210518). T7-5’UTR fragment was PCR-synthesized using the mutagenesis-modified pcDNA3.3-eGFP and T7-5’UTR-primer-F and T7-5’UTR-primer-R ...
-
bioRxiv - Genetics 2022Quote: ... Site directed mutagenesis was carried out according to the instructions accompanying the Quik-Change® Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene). The principal vector used for most A ...
-
bioRxiv - Cancer Biology 2022Quote: ... For secondary antibody staining, either ImmPRESS kits (anti-goat, MP-7405; anti-rat, MP-7444) or Envision+ Reagents (Dako: rabbit, K4002) were used ...
-
bioRxiv - Cancer Biology 2022Quote: ... K277Q or K277R directed mutagenesis was performed on this vector using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521), following manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... RNA quality and concentration were measured using an Agilent 2100 Bioanalyzer and the Agilent Nano Eukaryotic RNA Kit (Agilent, #5067-1511). All bioanalyzer assays were performed by the Stanford Protein and Nucleic Acid Facility.
-
bioRxiv - Physiology 2022Quote: ... The concentration and quality of the library were measured using the Agilent 2100 Bioanalyzer and Agilent’s High Sensitivity DNA Kit (Agilent, #5067-4626) by the Stanford Protein and Nucleic Acid Facility.
-
bioRxiv - Physiology 2022Quote: ... The concentration and quality of the amplified cDNA library were measured using the Agilent 2100 Bioanalyzer and Agilent’s High Sensitivity DNA Kit (Agilent, #5067-4626) by the Stanford Protein and Nucleic Acid Facility.
-
bioRxiv - Physiology 2022Quote: ... The glycolytic function metrics was calculated by Seahorse Wave Desktop Software as directed in the glycolysis stress kit manual (Agilent Technologies).
-
bioRxiv - Microbiology 2019Quote: Site-directed mutagenesis was carried out using a QuikChange II Site-Directed Mutagenesis Kit (Stratagene, Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: Trio WES of 13 patients and their parents was performed using the SureSelect Human All Exon V5+UTR kit (Agilent technologies). In patient 4 ...
-
bioRxiv - Neuroscience 2019Quote: ... pCMV-Tag-3B-2XMyc-LRRK2-D1994A was generated by mutagenesis of pCMV-Tag-3B-2XMyc-LRRK2-WT using a QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... The quantity of the bacterial RNA samples was measured on a NanoDrop ND1000 system and their quality analyzed on the Agilent 2100 Bioanalyzer system with the Agilent RNA 6000 Nano kit protocol (Agilent Technologies), according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... RNA quantification was performed using Qubit and Nanodrop 2000 and quality of the RNA was determined by the Bioanalyzer RNA 6000 Nano Kit (Agilent Technologies) for 10 random samples ...
-
bioRxiv - Plant Biology 2019Quote: ... The exact point mutations for each of the three Hsf1 missense mutations were engineered into the cDNA of ZmHK1 in the plasmid P415-CYC1-ZmHK1 plasmid with the QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) using the manufacturer’s specifications.
-
bioRxiv - Biochemistry 2019Quote: ... hhp1 and hhp2 mutants were created by mutagenizing pIRT2 plasmids containing hhp1+ and hhp2+ using a QuikChange site-directed mutagenesis kit (Agilent Technologies). For protein production ...
-
bioRxiv - Pathology 2020Quote: ... Mutations required for domain excision and/or punctual changes within P1 nucleotidic sequence were introduced in the P1 open reading frame using the QuikChange® II XL Site-Directed mutagenesis kit (Agilent-Stratagene) and related primers (Appendix Table 1) ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Genetics 2019Quote: ... Site directed mutagenesis was carried out according to the instructions accompanying the Quik-Change® Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene). The principal vector used for UapA mutants was pAN510-GFP carrying a gfp-tagged uapA gene ...
-
bioRxiv - Biophysics 2019Quote: ... The fusion constructs were generated by deletion of amino acids from the 5-HT3A-ICD using appropriate partially overlapping primers with the QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) and were confirmed by DNA sequencing (GENEWIZ ...
-
bioRxiv - Cancer Biology 2019Quote: ... according to the manufacturer protocol and purity as well as integrity controlled using the Agilent RNA 6000 nano kit (Agilent Technologies). RNA sequencing was performed on an Illumina NextSeq500™ platform ...
-
bioRxiv - Cancer Biology 2019Quote: ... Single-cell RNA-seq libraries were prepared according to the manufacturer’s protocol and the library quality was confirmed with a Bioanalyzer High-Sensitivity DNA Kit (Agilent, 5067-4627) and a Qubit dsDNA HS Assay Kit (ThermoFisher ...
-
bioRxiv - Cancer Biology 2020Quote: Ribonucleic acid was isolated from cells in indicated experimental conditions using a Qiagen miRNAeasy kit (Valencia, CA) and measured on an Agilent Bioanalyzer (Agilent Technologies). Illumina Novaseq 6000 libraries were prepared and sequenced by Novogene (CA ...
-
bioRxiv - Molecular Biology 2019Quote: ... Site directed mutagenesis was carried out according to the instructions accompanying the Quik-Change® Site-Directed Mutagenesis Kit (Agilent Technologies, Stratagene). The principal vector used for most A ...
-
bioRxiv - Microbiology 2019Quote: ... 39) with primers WNTP0548 (GAGTTATTGGGGGCTTGAAGT) and WNTP0549 (AATCCTTTTTCGATGTTGATAATTAAGTCG) and subjected to random mutagenesis using GeneMorph II EZClone Mutagenesis kit (Agilent Technologies) per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... pGEX(M)_cstK derivatives harboring different mutations were generated by using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA), and resulted in the construction of plasmids detailed in Table 2 ...