Labshake search
Citations for Agilent :
6151 - 6200 of 8383 citations for Human Adenosylhomocysteinase Like 1 AHCYL1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... ADAR1 point mutations were generated based on the ADAR1p150 sequence using the QuickChange II XL site-directed mutagenesis kit (Agilent). The doxycycline-inducible MDA5 construct was generated by replacing dCas9 with MDA5 CDS in the HR-TRE3G-dCas9-GCN4-10x-p2a-mCherry backbone ...
-
bioRxiv - Immunology 2022Quote: ... The SCIV construct was then used to create allelic variants at position 375 using the QuikChange II XL site-directed mutagenesis kit (Agilent). Wild-type and mutant plasmids were transformed into MAX Efficiency Stbl2 competent cells (ThermoFisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... The integrity of the HMW gDNA was verified on the Femto Pulse system using the Genomic DNA 165 kb Kit (Agilent Technologies ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Genetics 2022Quote: ... the other mtr4 mutant plasmids were constructed by site-directed mutagenesis of the MTR4 HIS CEN6 plasmid (pAC4096) with the QuikChange II Site-Directed Mutagenesis Kit (Agilent) and oligonucleotides containing the corresponding missense mutations ...
-
bioRxiv - Microbiology 2022Quote: ... Quality assessment and library size estimation of the individual libraries was done using an HS DNA kit (Agilent, #5067-4626) in a Bio analyzer 2100 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 ng of extracted PCR products were analyzed by an Agilent High Sensitivity DNA kit on an Agilent 2100 Bioanalyzer (Agilent), and the remainder was cloned by using PCR Cloning Kit (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... The RNA quality was assessed using the Agilent 2100 Bioanalyzer using RNA 6000 Pico kit (Agilent Technologies, Santa Clara, CA). qRT-PCR probe and primer sets (Table S2 ...
-
bioRxiv - Plant Biology 2022Quote: ... the concentration and fragment sizes of the DNA libraries were evaluated using the TapeStation 4200 kit (Agilent Technologies, United States) and the High Sensitivity D1000 kit.
-
bioRxiv - Molecular Biology 2023Quote: ... Site-directed mutagenesis was used to introduce mutations into the putative miR-423-5p binding sites on the Cacna2d2 3’UTR using the QuickChange II XL site-direct mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA integrity (RIN R 8.0) was confirmed using the High Sensitivity RNA Analysis Kit (DNF-472-0500, Agilent formerly AATI) on a 12-Capillary Fragment Analyzer ...
-
bioRxiv - Neuroscience 2023Quote: ... Amplified DNA from F1 mutants was used for cloning with the StrataClone PCR Cloning Kit (Agilent; Santa Clara, CA, USA) and then transformed with StrataClone SoloPack (Agilent ...
-
bioRxiv - Neuroscience 2023Quote: ... Quality and quantity assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Immunology 2022Quote: ... Quality check was performed with the Bioanalyzer 2100 using the Agilent High Sensitivity DNA Kit (both Agilent, Santa Clara, USA). Pooled sequencing-ready libraries of the WTA and sample tag were sequenced on Illumina NovaSeq 6000 (150 bp ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We extracted RNA using the Qiagen RNeasy Blood and Tissue Kit and checked RNA integrity with a TapeStation 2200 (Agilent). Only two samples had RNA integrity numbers (RIN ...
-
bioRxiv - Neuroscience 2022Quote: RNA-Sequencing RNA was extracted from dorsal hippocampus (DH) 500 µm punches and RNA quality and concentration was evaluated using RNA 6000 pico kit for Bioanalyzer (Agilent) with a cutoff of 9 for the RIN ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, USA). Sequencing libraries were generated using the NEBNext UltraTM RNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... Taq DNA polymerase from New England Biolabs (in the presence of Mn2+) and GeneMorph II Random Mutagenesis Kit from Agilent were used for error-prone PCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... Single-mutant variants of glutamine synthetase were prepared by site-directed mutagenesis using the QuikChange Lightning kit (Agilent technologies, USA). The gene coding for γ-glutamyl phosphate reductase was ligated into the pHTP1 expression vector (GenScript Biotech ...
-
bioRxiv - Molecular Biology 2022Quote: ... AAV-LK03insT and AAV-AM were created by inserting a Threonine or Glycine respectively immediately downstream of the Serine at position 264 of the AAV-LK03 capsid using the QuikChange in vitro mutagenesis kit (Agilent).
-
bioRxiv - Molecular Biology 2022Quote: ... residues N71 and R72 of the σB subunit were replaced by six σA residues (segment 272-KLPAAQ-277) using the Quick Change Lightening site-directed mutagenesis kit (Agilent). Residues 811-825 in the Mtb RNAP β flap were deleted using Quick Change II XL site-directed mutagenesis kit (Agilent) ...
-
bioRxiv - Microbiology 2022Quote: ... Mutations were made on pDUAL plasmids encoding the PR8 gene (64) using a QuikChange II site directed mutagenesis kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Genomics 2022Quote: RNA quality was evaluated using Agilent RNA 6000 Nano Kit on the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, USA). RNAseq libraries were prepared using TruSeq Stranded Total RNA Library Prep Gold (Illumina ...
-
bioRxiv - Plant Biology 2022Quote: ... was used as a template to create different promoter mutants using the QuikChange II kit according to manufacturer’s protocol (Agilent Technologies). Mutagenic mismatch primers are listed in Tab ...
-
bioRxiv - Microbiology 2022Quote: ... on a Qubit Fluorometer (invitrogen) and fragment length was assessed with an Agilent 2100 Bioanalyzer (Agilent High sensitivity DNA Kit, Agilent). Samples were equimolarly pooled and sequenced on NextSeq™ 500 High Output Kit v2.5 (75 cycles ...
-
bioRxiv - Cell Biology 2022Quote: ... on a OCR and ECAR were measured using a Seahorse XF Cell Mito Stress Test kit (103015-100, Agilent Technologies) as described above.
-
bioRxiv - Cell Biology 2022Quote: ... and the RNA integrity was determined with an RNA ScreenTape Kit on the TapeStation 2200 system (Agilent, Santa Clara, CA). cDNA libraries were prepared from RNA extracts with a minimum RNA integrity number (RIN ...
-
bioRxiv - Cell Biology 2022Quote: ... The sequencing library was determined by an Agilent 2100 Bioanalyzer using the Agilent DNA 1000 Chip Kit (Agilent, #5067-1504). Differentially expressed genes (DEGs ...
-
bioRxiv - Cell Biology 2022Quote: The quantity and quality of RNA samples were analyzed using Agilent RNA 6000 Nano kit with the bioanalyzer from Agilent. RNA samples with RNA Integrity Number (RIN ...
-
bioRxiv - Neuroscience 2024Quote: ... Final library concentration was assessed by Qubit dsDNA HS Assay Kit (Thermo-Fischer Scientific) and fragment size was checked using Tapestation High Sensitivity D1000 (Agilent) to ensure that fragment sizes were distributed normally about 500 bp ...
-
bioRxiv - Neuroscience 2024Quote: ... Point amino acid substitutions in genes encoding GluN subunits were performed using the QuikChange site-directed mutagenesis kit (Agilent Technologies) and verified by DNA sequencing.
-
bioRxiv - Neuroscience 2024Quote: ... Purified RNA was quantified using a NanoDrop spectrophotometer and RNA quality was further checked with an Agilent 2100 Bioanalyzer using the RNA nano kit (Cat Nº 5067-1511, Agilent). Only samples with RIN>9 were used for library preparation ...
-
bioRxiv - Neuroscience 2024Quote: ... The Lgmn mutation leading to an inactive LGMN C191A variant40,68 was introduced by site-directed mutagenesis using the QuickChange Site-Directed Mutagenesis Kit (# 200519, Agilent Technologies) according to manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2024Quote: ... with the NucleoBond HMW DNA kit (Macherey Nagel, Düren, Germany) and DNA quality was assessed by capillary electrophoresis (Agilent FEMTOpulse). For PacBio library preparation ...
-
bioRxiv - Physiology 2024Quote: ... Total RNA was amplified and Cy3-labeled by using the one-color Low Input Quick Amp Labeling Kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... Site-directed mutagenesis of this clone was conducted to generate a genomic clone of NRL5P335L using the QuikChange II site-directed mutagenesis kit (Agilent) following the manufacturer’s instructions ...
-
Mutations in HUA2 restore flowering in the Arabidopsis trehalose 6-phosphate synthase1 (tps1) mutantbioRxiv - Plant Biology 2024Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit on the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). RNA-seq libraries were generated with three independent biological replicates and sequenced on the Illumina NovaSeq platform by Annoroad Gene Technology ...
-
bioRxiv - Plant Biology 2024Quote: ... Fragmentation (at 60 °C) and hybridization (at 65° C for 16 hours) were done using the Gene Expression Hybridization kit of (Agilent Technologies ...
-
bioRxiv - Microbiology 2024Quote: To detect changes in neutralisation potency single point mutations were introduced into env encoding plasmids for PV production using the QuikChange Lightning Site-Directed Mutagenesis (SDM) kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: Mitochondrial bioenergetics of MDMs and DCs were measured using the Seahorse XF Cell Mito Stress Test Kit and the XF24 Extracellular Flux Analyzer (Agilent), as previously described (100) ...
-
bioRxiv - Cell Biology 2024Quote: ... Point mutations in Cebpa p42 were introduced by site-directed mutagenesis using the QuikChange Site-Directed Mutagenesis Kit (Stratagene #200518). Primers used for single mutant exchange were ...
-
p110α-dependent hepatocyte signaling is critical for liver gene expression and its rewiring in MASLDbioRxiv - Cell Biology 2024Quote: ... cyanine-3 (Cy3) labeled cRNA was prepared from 200 ng of total RNA using the One-Color Quick Amp Labeling kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... One microgram or more of mouse genomic DNA from each sample was analyzed by whole exome sequencing using the SureSelectXT Mouse All Exon kit (Agilent), followed by next generation sequencing using the NovaSeq 6000 S4 flow cell (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were then quantified using Qubit 1x dsDNA HS Assay Kit for concentration and D1000 ScreenTape (Agilent Technologies, 5067-5582) for length ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10X-barcoded full-length cDNA was then amplified by PCR and analysed using Bioanalyzer High Sensitivity DNA kit (5067-4626, Agilent). Up to 50 ng of cDNA was carried over to construct gene expression libraries and was enzymatically fragmented and size-selected to optimize the cDNA amplicon size prior to 5’ gene expression library construction ...
-
bioRxiv - Molecular Biology 2024Quote: ... The RNA Integrity Number (RIN) for all samples was 10 as assessed by an RNA Nano Kit (Agilent #5067-1511) on an Agilent Bioanalyzer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Site directed mutagenesis of pORIPS and pGII was performed by PCR using the QuikChange II Site-directed mutagenesis kit (Agilent).
-
bioRxiv - Molecular Biology 2024Quote: Primary mouse AT2s were isolated and plated as described above with measurement of mitochondrial respiration performed using the Seahorse XF Cell Mito Stress Test Kit (Agilent) or the Seahorse XF Palmitate Oxidation Stress Test Kit (Agilent ...
-
bioRxiv - Molecular Biology 2024Quote: ... at a ratio of 0.8:1 beads:cDNA (20 μl beads:25 μl cDNA for Smart-seq2 and 8 μl beads:10 μl cDNA for Smart-seq3) and inspected on a Bioanalyzer 2100 (High Sensitivity DNA kit, Agilent).