Labshake search
Citations for Agilent :
5401 - 5450 of 5718 citations for Rat Cystatin S CST4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... RNA was eluted into 10 μL of nuclease free water and analyzed on Agilent 2100 Bioanalyzer using the RNA 6000 Pico kit (Agilent, catalog #5067-1513). For protein analysis ...
-
bioRxiv - Bioengineering 2020Quote: ... ENVs were collected 3 days after electroporation and analyzed for miR-101-3p content by RT-PCR using the qScript microRNA cDNA Synthesis Kit (Quanta Biosciences, Beverly, MA) and SYBR Mastermix (Quanta Biosciences) on a Stratagene Mx 3000 P (Stratagene, San Diego, CA). The primer for miR-101-3p was (TACAGTACTGTGATAACTGAA) ...
-
bioRxiv - Biochemistry 2020Quote: ... USA) and RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA). A total amount of 2 μg RNA per sample was used as input material for the RNA sample preparations ...
-
bioRxiv - Cancer Biology 2020Quote: Extracellular acidification rate (ECAR) was analyzed on a XF96 Extracellular Flux Analyzer using XF Glycolysis Stress Test Kit (Agilent Technology, Santa Clara, CA) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... and RNA integrity and quantitation were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). A total of 9 RNA libraries were prepared with three paired biological replicates for each condition including control +LIF2i ...
-
bioRxiv - Cell Biology 2021Quote: ... We performed exome sequencing in the child with neonatal diabetes and his consanguineous parents using the Agilent SureSelect Human All Exon Kit (Agilent SureSelect v4, 50Mb). We analyzed the data with our established pipeline in the institute (Kuhnen ...
-
bioRxiv - Plant Biology 2020Quote: RNA sample concentration and purity was assessed using the DeNovix DS-11 spectrophotometer (DeNovix Inc., Wilmington, DE, USA) and concentration and integrity were assessed using the Agilent RNA 6000 Nano Kit (Agilent Technologies, Waldbronn, Germany) in conjunction with the Agilent 2100 Bioanalyzer software according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Following visualization and an estimation of the concentration using the High Sensitivity D1000 DNA Kit on the Agilent 2200 TapeStation system (Agilent Technologies, CA, USA), the samples were pooled according to concentration ...
-
bioRxiv - Genomics 2021Quote: ... Library quality control was performed using the 2100 Bioanalyzer System with the Agilent High Sensitivity DNA Kit (Agilent Technologies, Santa Clara, CA, USA). The libraries were individually quantified via qPCR using a KAPA Library Quantification Kits (Kapa Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... The average sample fragment length and purity was determined using Agilent High Sensitivity DNA kit and the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA). After passing quality control measures ...
-
bioRxiv - Neuroscience 2020Quote: ... One microliter of sample was used to determine the concentration (Qubit 3.0 fluorometer) and integrity (Agilent 2100 Bioanalyzer, Agilent High Sensitivity DNA Kit). RNA sequencing was performed using the PE100 strategy (HiSeq 2500 ...
-
bioRxiv - Microbiology 2021Quote: RNA quality was evaluated spec-trometrically by Trinean Xpose (Gentbrugge, Belgium) and by fragment size distribution on an Agilent 2100 Bioanalyzer with the RNA Nano 6000 kit (Agilent Technologies, Böblingen, Germany). Electropherograms for the endpoint RNAseq samples were exported as XML files for further analysis ...
-
bioRxiv - Cancer Biology 2021Quote: ... Total amounts and integrity of RNA were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). mRNA was purified from total RNA by using poly(T ...
-
bioRxiv - Microbiology 2019Quote: ... Library size distribution was determined using a High-Sensitivity DNA Kit run on a Bioanalyzer 2100 instrument (Agilent Technologies, Santa Clara, CA, USA). Pooled ...
-
bioRxiv - Microbiology 2019Quote: ... A synonymous mutation in the EagI site within the BSD coding sequence was then introduced to inactivate this site using a QuikChange Lightning Multi Site Directed Mutagenesis kit (Agilent, Santa Clara, CA) and the primer GCCAGCGCAGCTCTCTCTAGCGACGGGCGCATCTTCACTGGTGTCAATG ...
-
bioRxiv - Microbiology 2019Quote: ... purity was evaluated using NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies) and the integrity was verified using the Agilent RNA 6000 Pico Kit (Agilent Technologies, 5067-1513) in the 2100 Bioanalyzer Instrument (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2021Quote: ... The sheared DNA samples were quantified and qualified on a BioAnalyzer system using the DNA7500 assay kit (Agilent Technologies cat no. 5067-1506). With an input of maximum ...
-
bioRxiv - Microbiology 2021Quote: ... samples were run on an Agilent Bioanalyzer 2100 using an Agilent High Sensitivity DNA kit as recommended by the manufacturer (Agilent Technologies, Waldbronn, Germany). Concentrations of the libraries were determined using the Qubit® dsDNA HS Assay Kit as recommended by the manufacturer (Life Technologies GmbH ...
-
bioRxiv - Cell Biology 2020Quote: ... and Nup133-mEGFP(-7) were cloned from the repair template plasmids constructed above via the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA). For each CRISPR cell line ...
-
bioRxiv - Biophysics 2021Quote: ... were created using a 1.3mer HBV plasmid (gifted by Dr. Haitao Guo)(59) and site-directed mutagenesis kit (QuikChangeII, Agilent Technologies, Santa Clara, CA) with corresponding primers (University of Calgary DNA Synthesis Lab ...
-
bioRxiv - Cell Biology 2021Quote: ... was then mutated to either R to mimic deacetylated c-Myc (K323R) or Q to mimic acetylated c-Myc (K323Q) using QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies, 200522-5) against pPHAGE-EF1α-HA-Puro-c-Myc ...
-
bioRxiv - Neuroscience 2022Quote: ... The quality and profile of individual libraries have been quantified and visualized using Qubit™ and the Agilent Bioanalyzer dsDNA High Sensibility Kit (Agilent Technologies, USA) respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... Purified RNA was then subjected to RNA integrity number (RIN) calculation using the Agilent RNA 6000 Pico kit (Agilent Technologies, Santa Clara, CA). RINs exceeding the Visium optimization threshold of 7.0 were confirmed for sections from all three blocks of interest.(40)
-
bioRxiv - Immunology 2022Quote: ... a variant mutated to change the tyrosines at positions 179 and 181 to phenylalanines was generated using a QuikChange II Site-Directed Mutagenesis Kit (#200523; Agilent, Santa Clara, CA) and the primer 5’ CATCCCCGCCTTCGCCTTCTATGTCTCACGTTGG 3′ ...
-
bioRxiv - Biochemistry 2022Quote: ... The pcDNA3.1 Flag-mRBPJ A284V CRr and the pcDNA3.1 Flag-mRBPJ F261A/A284V CRr were generated via site directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies 200521-5) accordingly to manufacturer’s instructions with the oligos listed in Table S6 and using the pcDNA3.1 Flag-mRBPJ WT CRr and the pcDNA3.1 Flag-mRBPJ A284V CRr as templates ...
-
bioRxiv - Developmental Biology 2022Quote: ... The RNA integrity was assessed using an Agilent 2100 Bioanalyzer using an RNA 6000 Nano LabChip kit (Agilent Technologies, Santa Clara, CA, USA). All samples had a 260:280 ratio > 2.0 and an RNA integrity number (RIN ...
-
bioRxiv - Immunology 2022Quote: Specific amino acid changes on envelope clones and CAP206-CH12 heavy chain CDRH3 were introduced using the QuikChange Lightning Site-Directed Mutagenesis Kit (catalog #210519, Agilent Technologies, CA, USA). Mutations were confirmed by sequence analysis.
-
bioRxiv - Developmental Biology 2022Quote: ... High quality total RNA (RNA integrity number = 10) was labelled with Cyanine 3 CTP using the Low Input Quick Amp Labelling Kit (Agilent Technologies-5190-2305), and purified using Qiagen’s RNeasy Mini Spin Columns ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... samples were run on an Agilent Bioanalyzer 2100 using an Agilent High Sensitivity DNA Kit as recommended by the manufacturer (Agilent Technologies, Waldbronn, Germany). Concentration of the libraries were determined using the Qubit® dsDNA HS Assay Kit as recommended by the manufacturer (Life Technologies GmbH ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA quality was assessed on 1% agarose gels and with the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). For each sample ...
-
bioRxiv - Microbiology 2021Quote: ... The average sample fragment length and purity was determined using the Agilent High Sensitivity DNA kit and the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA). After passing quality control measures ...
-
bioRxiv - Molecular Biology 2021Quote: ... was used to create fluorescent complementary RNA (cRNA) followed by hybridization to microarrays using Gene Expression Hybridization Kit (Agilent Technologies, Santa Clara, USA). Fluorescence signals were detected using SureScan Microarray Scanner (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... from the pIdsBB expression system containing a C-terminal GFPmut2 fusion (Gibbs et al., 2008) using error-prone PCR with the GeneMorph II Random Mutagenesis Kit (Agilent, Santa Clara, CA) and ligated back into the same pIdsBB expression vector using the restriction enzymes SacI and BamHI ...
-
bioRxiv - Molecular Biology 2020Quote: ... samples were then loaded in equal volumes into 24 wells of an Agilent 3100 OFFGEL Fractionator using a high-resolution fractionation kit (Agilent Cat#5067-0201). Each sample ...
-
bioRxiv - Immunology 2020Quote: ... The amplified total cDNAs were analyzed by an Agilent 2100 Bioanalyzer using the Agilent High Sensitivity DNA Kit (Agilent Technologies, Santa Clara, CA) and sheared to 150bp on the Covaris S2 machine (Covaris ...
-
bioRxiv - Immunology 2020Quote: ... Approximately 400 ng of amplified cDNA was used to generate the Illumina sequencing library using the Agilent SureSelectXT Target Enrichment Kit (Agilent, Santa Clara, CA) for Illumina Multiplex Sequencing by using enrichment probes designed for A/California/04/2009(H1N1 ...
-
bioRxiv - Biophysics 2020Quote: ... A thrombin site was introduced between the 6xHis-tag and the coiled-coil using the QuikChange Lightning mutagenesis kit (Agilent, Santa Clara, USA). Sequences of the products were confirmed by DNA sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... RNA quality and quantity were determined using Agilent RNA6000 Nano kit by capillary electrophoresis (Agilent 2100 bioanalyzer, Agilent Technologies, Santa Clara, CA, USA). cDNA was synthesized from 1 μg of total RNA using oligo-dT primer and Superscript III reverse transcriptase (RT ...
-
bioRxiv - Microbiology 2022Quote: ... and H249A were generated from the parent pLVX Kernow C1/p6 ORF1AAAPG-Ha tag-AAAPG IRES zsGreen construct via QuikChange XL site-directed mutagenesis kit (Stratagene, La Jolla, CA). using primers listed in (Supplementary Table 1).
-
bioRxiv - Evolutionary Biology 2022Quote: ... Library qualities were assessed with the High Sensitivity D1000 ScreenTape Assay Kit and the Agilent 4200 TapeStation system (Agilent, Santa Clara, United States). The libraries of all three insect species were sequenced on NovaSeq 6000 at the Institute of Clinical Molecular Biology (IKMB ...
-
bioRxiv - Immunology 2022Quote: ... Total amounts and integrity of RNA were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). mRNA was purified from total RNA by using poly-T oligo-attached magnetic beads ...
-
bioRxiv - Genetics 2019Quote: ... Glu2759Cysfs*9 and G2003R were introduced into a wild-type (WT) pEGFP-FBN1 QuikChange Lightning Site-directed Mutagenesis Kit (Agilent Technologies, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2019Quote: ... FLAG-tag was inserted between the CAAX motif (CVIQ) and stop codon in the full-length construct (Cat No: 200523, QuickChange II Site-Directed Mutagenesis kit, Agilent Technologies, Lexington, MA). For removal of the INF2 cleavage site ...
-
bioRxiv - Plant Biology 2019Quote: ... Quality and quantity of each RNA sample were checked using an Agilent RNA 6000 Nano Kit Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). All RNA samples were stored at −80°C.
-
bioRxiv - Genetics 2020Quote: ... the exonic regions and flanking splice junctions of the genome were captured using the Clinical Research Exome kit (Agilent Technologies, Santa Clara, CA). Massively parallel (NextGen ...
-
bioRxiv - Cancer Biology 2020Quote: ... The quality of the library was assessed using High Sensitivity D1000 kit on a 2200 TapeStation instrument (Agilent Technologies, Santa Clara, CA, USA). Sequencing was performed using the NovaSeq 6000 Sequencing System (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: ... The mutated variants of AopW1 were generated by inserting mutations in the corresponding primers in combination with the Quick Change Lightening Site Directed Mutagenesis kit (Agilent Technologies, SC, USA). For this purpose ...
-
bioRxiv - Plant Biology 2020Quote: ... Site-directed mutagenesis to generate the different H3.1 point mutant constructs was performed using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). The ADA2b coding sequence was cloned into pETDuet-1 (Millipore ...
-
bioRxiv - Immunology 2021Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative PCR of complementary DNA was performed using the DyNAmo HS SYBR Green kit (Thermo-Fisher, Cat # F410L) on an Mx3000P machine (Stratagene, La Jolla, CA) using the primers listed in Supplementary File 3 ...