Labshake search
Citations for Agilent :
5151 - 5200 of 7040 citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... deparaffinized sections were subjected to antigen retrieval and processed with the EnVision+ HRP kit (K401111–2, DAKO, Glostrup, Denmark) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The digested samples were also qualified on Agilent 2100 Bioanalyzer using High Sensitivity DNA Kit (Agilent Technologies, 5067-4626). The condition giving approximately 65% mono- ...
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding the single-mutation variants found in P.1 and 10-mutation variant (BZΔ10) were generated by Quikchange II XL site-directed mutagenesis kit (Agilent). Recombinant Indiana VSV (rVSV ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA library quality was quantified by a 2100 Bioanalyzer using an Agilent high-sensitivity DNA kit (Agilent, 5067-4626). Libraries were sequenced separately as 75-bp single ends on an Illumina NextSeq 500.
-
bioRxiv - Neuroscience 2021Quote: ... which were assessed by the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Sequencing libraries were prepared using the NEB Next Ultra RNA Library Prep Kit (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: Mitochondrial respiration in live MSCs were measured using seahorse XF24 Extracellular Flux Analyzer with Mito stress test kit according to manufacturer’s protocol (Agilent). In brief ...
-
bioRxiv - Microbiology 2020Quote: Electrophoretic analyses were performed on the TapeStation 4500 (D1000 Screen Tape and D1000 Reagents kits; all from Agilent Technologies) or by horizontal electrophoresis using a 2% (w/v ...
-
bioRxiv - Cancer Biology 2020Quote: ... The fragment size of the final libraries was determined using the Bioanalyzer High-Sensitivity DNA Kit (Agilent, CA, USA). Their concentration was determined using the Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... were introduced into the BG505 SOSIP.v5.2 pPPI4 vector 53 using the QuikChange® Lightning Site-Directed Mutagenesis kit (Agilent). The R500A and Q658K mutations were added to the BG505 SOSIP.v5.2.N241.N289 vector ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA integrity was assessed using Agilent’s Eukaryotic Total RNA 6000 Nano Kit on an Agilent 2100 BioAnalyzer (Agilent Technologies), and the concentration was subsequently measured using the Qubit RNA HS assay (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA quality was assessed using 2100 Bioanalyzer G2938C using an Agilent RNA 6000 Nano Kit (Agilent; Cat # 5067-1511) and Qubit 4 Fluorometer (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... in one individual by the Hospital for Sick Children (Toronto, Canada) using the Agilent SureSelect Focused Exome Kit (Agilent); in one individual at Hôpital de la Pitié Salpêtrière (Paris ...
-
bioRxiv - Developmental Biology 2022Quote: ... The average length distribution of the fragmented cDNA libraries was assessed by the high sensitivity DNA kit (Agilent, USA) and the libraries quantified by Qubit (Thermo Scientific ...
-
bioRxiv - Genomics 2022Quote: ... while library quality checks were performed using an Agilent 2100 Bioanalyzer and High Sensitivity DNA Kit (Agilent Technologies Ltd.). Individually barcoded RNA-seq libraries were pooled in equimolar quantities and the quantity and quality of the final pooled libraries (two different pools in total ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... All samples were quantified by a Bioanalyzer using the Agilent RNA 6000 Nano Kit reagents and protocol (Agilent Technologies). Only RNA samples with RNA Integrity Number (RIN ...
-
bioRxiv - Genomics 2022Quote: ... Individually indexed IgG and IgM libraries were assessed using the Agilent 2100 Bioanalyzer High Sensitivity DNA Assay Kit (Agilent) and the Qubit 3.0 Fluorometer dsDNA High Sensitivity Assay Kit (Life Technologies) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Amplified cDNA and final libraries were assessed on an Agilent BioAnalyzer using a High Sensitivity DNA Kit (Agilent Technologies). All the libraries were sequenced on NovaSeq 6000 (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... Amplified cDNA and final libraries were assessed on an Agilent BioAnalyzer using a High Sensitivity DNA Kit (Agilent Technologies).
-
bioRxiv - Cancer Biology 2019Quote: ... The pBabe-KRAS point mutation Q61H was created by using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) following the recommended protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Pair1 and Rejoin1 mutations were introduced using the site-directed mutagenesis commercial kit QuickChange® II XL (Agilent, CA) according to the manufacture’s protocol ...
-
bioRxiv - Immunology 2019Quote: ... A928V and TYK2-ΔE8 were generated by site-directed mutagenesis using QuickChange XL site-directed mutagenesis kit (Agilent Technologies) in pRc-TYK2 or pQE-His-N [22] ...
-
bioRxiv - Bioengineering 2019Quote: ... RNA integrity was assessed using the RNA Nano 6000 assay kit and the Agilent Bioanalyzer 2100 system (Agilent Technologies).
-
bioRxiv - Plant Biology 2019Quote: ... The Msrab11f1(S29N) mutant was generated using QuikChange II Site-Directed Mutagenesis Kits performed according to the manufacturer’s manual (Stratagene) with the primers CTGGAGTTGGGAAAAACAATCTGCTTTCAAGG ...
-
bioRxiv - Cell Biology 2019Quote: ... Amplified cDNA and final libraries were evaluated on a Agilent BioAnalyzer using a High Sensitivity DNA Kit (Agilent Technologies). Individual libraries were diluted to 4nM and pooled for sequencing ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA quantity and quality was measured using an Agilent 2100 Bioanalyzer with the 6000 Pico Kit (Agilent, 5067-1513).
-
bioRxiv - Biochemistry 2020Quote: Site-directed mutagenesis was performed according to the manufacturer’s instructions of QuikChange® Site-Directed Mutagenesis Kit (Agilent Technologies). The reactions were conducted using as template the plasmid pET28a-XfybbN and pET15b-EcYbbN ...
-
bioRxiv - Cancer Biology 2019Quote: ... we undertook massively parallel sequencing using a solution-phase SureSelect hybrid capture kit (Agilent Technologies, Santa Clara, CA, USA) and an HiSeq 2500 sequencer (Illumina) ...
-
bioRxiv - Cell Biology 2019Quote: Methionine153 on pHluorin in pcDNA3.1-pHluorin-CD6320 was mutated to Arginine using QuickChange II XL Site-Directed Mutagenesis Kit (Agilent) with a pair of primers (Forward ...
-
bioRxiv - Immunology 2019Quote: ... MG505.A3 or MG505.H3) was altered by site-directed mutagenesis using the QuikChange site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... thermophilus GyrB overexpression 12 was mutated by site directed mutagenesis using the QuikChange XL Site-Directed Mutagenesis kit (Agilent) in order to generate two plasmids harboring K284R or K284Q mutations ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Site-directed mutagenesis of BenM in pMeLS0076 was carried out using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2019Quote: ... pME-hB3GALT4-3HA was used as a template and mutagenized by a commercial site-directed mutagenesis kit (Agilent Technologies). UGCG mutant plasmid ...
-
bioRxiv - Molecular Biology 2020Quote: ... Synthesis of cDNA was carried out using the AffinityScript qPCR cDNA Synthesis Kit and random primers (Agilent Technologies, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2020Quote: ... The average size and concentration of all libraries were analysed using the 2100 Bioanalyzer High Sensitivity DNA Kit (Agilent) followed by qPCR quantification using SensiMix SYBR (Bioline ...
-
bioRxiv - Cancer Biology 2020Quote: ... The Flag-tagged PARP1 R138C mutant was generated by the site-directed mutagenesis Kit (Agilent, La Jolla, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... the parental Env-encoding plasmid was altered by site-directed mutagenesis using the QuikChange site-directed mutagenesis kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Mutant ORFs (FGFR2 M538I, N550K and K660N) were made using QuickChange II site-directed mutagenesis kit (Agilent Technologies #200523). Most stable cells lines express ORFs in pLX317 vector and were selected with puromycin (Life Technologies #A1113803) ...
-
bioRxiv - Bioengineering 2020Quote: ... Calibration was performed using PEG standards of molecular weights up to 300,000 MW (Agilent PEG calibration kit, Agilent Technologies). Molecular weight and dispersity values were calculated using LabSolutions GPC software (Shimadzu Europa GmbH) ...
-
bioRxiv - Genetics 2020Quote: ... RNA integrity was assessed using the RNA Nano 6000 Assay Kit of Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Isolated RNAs were preserved on the condition of −80°C until reverse transcription.
-
bioRxiv - Molecular Biology 2021Quote: ... Amplified cDNA and final libraries were evaluated on an Agilent BioAnalyzer using a High Sensitivity DNA Kit (Agilent Technologies). Libraries were sequenced with PE100 on the DNBSEQTM NGS technology platform (BGI ...
-
bioRxiv - Zoology 2021Quote: ... and quality control of the libraries was implemented using Bioanalyzer 2100 instrument and the DNA High Sensitivity kit (Agilent). Sequencing was performed on an Illumina HiSeq 4000 system ...
-
bioRxiv - Plant Biology 2020Quote: ... deletions or insertions in WHIRLY coding sequences the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies, Santa Clara, USA) was used according to the manufacturer’s instructions with minor modifications ...
-
bioRxiv - Neuroscience 2020Quote: ... Quality and concentration of libraries from individual samples were assessed using the High Sensitivity dsDNA kit (Agilent, 067-4626) on a 2100 Bioanalyzer (Agilent ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was extracted from cryopreserved tumour samples or cultured cells using the Total RNA Isolation Micro kit (Agilent) and cDNA then synthesized using SuperScript VILO cDNA synthesis kit (Life Technologies) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The miR159 recognition site was altered by directed mutagenesis using a QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies); the amino acid sequence was not changed ...
-
bioRxiv - Microbiology 2021Quote: ... RNA quality was assessed using the Agilent RNA 6000 pico kit on an Agilent 2100 Bioanalyzer (Agilent Technologies, USA); only replicates where all samples had an RNA integrity number (RIN ...
-
bioRxiv - Systems Biology 2020Quote: ... and centrifuged again to remove the supernatant.RNA was then extracted from the isolated disc cells using Absolutely RNA Nanoprep Kit (Stratagene), following manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... as well as size and concentration assessment with a 2100 Bioanalyzer and the Agilent DNA 1000 Kit (Agilent Technologies). We also extracted gDNA from the two sperm samples as described by Hammoud and colleagues [4] ...
-
bioRxiv - Genomics 2019Quote: ... RNA quality and quantity were respectively assessed using Agilent RNA 6000 Pico kit on Agilent 2100 Bioanalyzer (Agilent Technologies) and Qubit RNA HS assay kit on Qubit 3.0 Fluorometer (Thermo Fischer Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... in plasmid containing LshCas13a locus and a CRISPR array carrying a spacer targeting RFP mRNA (pC003_RFP1) using QuikChange Site-Directed Mutagenesis kit (Agilent) and the mutagenic primers containing the desired mutations (Supplementary Table 2 ...