Labshake search
Citations for Origene Technologies :
251 - 300 of 483 citations for Mouse IgG2a Isotype Control Antibody HOPC 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Antibodies used are as follows: for immunoprecipitation (OriGene, CAT #TA-50011-3 and Origene ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... HEI-OC1 cells were transfected with a mouse Tlr4 expression clone (Origene; MR210887) to test for complementation of the Tlr4 deletion strain ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-tagged mouse Suv39h1 (NM_011514) was purchased from Origene (#MG206488; Rockville, MD, USA). pEGFP-C1-human SUV39H1 was previously described [7] ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse Pla2g2a-Myc-DDK construct was obtained from Origene (m-sPLA2-IIA-myc). Mouse PGRN construct was cloned into pSecTag2B vector (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Rabbit polyclonal anti-CCL5 antibody (Origene Cat# PP1081P1, RRID:AB_1006884) was used for the neutralization of CCL5 chemokine.
-
bioRxiv - Biochemistry 2022Quote: ... and the other with anti-METTL7A primary antibody (Origene, Rockville MD ...
-
bioRxiv - Molecular Biology 2019Quote: ... The antibodies used include: anti-turboGFP (Origene, cat # TA150041), -PDHA1 (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2020Quote: ... anti-TRAF6 or anti-MEKK3 antibodies (all from Origene). A rabbit monoclonal anti-BST-2 antibody (Abcam ...
-
bioRxiv - Genetics 2020Quote: ... Membranes were immunoblotted using antibodies against Psf1 (Origene, TA339351) Psf2 (Novus Biologicals ...
-
bioRxiv - Developmental Biology 2021Quote: ... The CatSper1 ORF was amplified from a mouse cDNA clone (Cat. No. MR224271, Origene). C2cd6s was subcloned into pcDNA3.1/myc-His A vector (Cat ...
-
bioRxiv - Neuroscience 2019Quote: ... DNA sequences containing mouse C4B (NM_009780.2, synthesized by Genescript) and human C4A (RC235329, Origene) were subcloned (InFusion Kit ...
-
bioRxiv - Neuroscience 2021Quote: The pCMV6-Arc-Myc-DDK (FLAG) mouse ORF cDNA clone (MR206218) was from OriGene Biotechnologies (Rockville ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs constructs targeting human or mouse ATRX were obtained from OriGene (Rockville, MD, USA). The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA for mouse Btbd11 was purchased C-terminal Myc tag (Origene catalog number: MR217199). Using this cDNA as template pCAG-GFP-Btbd11 was generated ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse Climp-63 tagged with Myc-DDK in the C terminal (Origene Catalog: MR215622) was cloned in an Ad5 backbone from Vector BioLabs ...
-
bioRxiv - Systems Biology 2023Quote: ... cells were transfected with 100 ng Fgf1 (NM_010197) Mouse Tagged ORF Clone (ORIGENE, MR201152) or control empty vector using Lipofectamine 3000 Transfection Reagent (Invitrogen ...
-
bioRxiv - Genomics 2024Quote: Knock-out was performed using the TDG mouse Gene Knock-Out kit (Origene, KN317363). This kit contained two gRNAs that targeted the first exon of TDG gene and a donor vector that contained a GFP-Puromycin cassette to facilitate the screening process ...
-
bioRxiv - Neuroscience 2020Quote: Full-length cDNAs encoding mouse IgSF8 (BC048387) and Tenascin-R (BC138043) were purchased from Origene and Source Bioscience ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B, OriGene, Rockville, MD, USA). A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V ...
-
bioRxiv - Genomics 2021Quote: The Zcchc8 KN2.0 non-homology mediated mouse gene knockout kit (KN519669) was purchased from OriGene. Either the pCas-Guide CRISPR vector (OriGene ...
-
bioRxiv - Physiology 2020Quote: The mouse clone of LRMP in pCMV6 was purchased from OriGene (Rockville, MD; Cat. #MC228229). The mouse variant of IRAG in pReceiver-M61 was purchased from GeneCopoeia (Rockville ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP-tagged human sclerostin (#RG217648)- and myc-tagged mouse sclerostin (#MR222588) were purchased from Origene. KillerRed plasmid (FP966 ...
-
bioRxiv - Neuroscience 2023Quote: ... Each virus expressed the full-length sequence for either mouse Elp1 (Origene MC202501, NM 026079) or human ELP1 (Origene RC2076868) ...
-
bioRxiv - Microbiology 2021Quote: ... Primary antibodies against SC2 included rabbit anti-Nucleoprotein MAb (Origene) and rabbit anti-Spike MAb (Origene) ...
-
bioRxiv - Microbiology 2021Quote: ... and immunostained with antibodies against IFIT1 (Origene TA500948, clone OTI3G8), MX1/2 (Santa Cruz sc-47197) ...
-
bioRxiv - Cell Biology 2021Quote: ... and anti-Rab IgG secondary rabbit antibody (OriGene Technologies, U.S.) were diluted at 1:5000 for incubation with the membrane ...
-
bioRxiv - Neuroscience 2019Quote: The following antibodies were used: FRMPD2 (rabbit, Sigma;rabbit, Origene), Flag(mouse ...
-
bioRxiv - Immunology 2020Quote: ... and rabbit anti-CCR7 polyclonal antibody (TA310252, Origene, Rockville, MD). The secondary antibodies were FITC- ...
-
bioRxiv - Neuroscience 2024Quote: ... Immunohistochemistry was performed using the following antibodies: SETD7 (Origene, TA503322), GFP (Aves Lab ...
-
bioRxiv - Neuroscience 2019Quote: ... cells were co-transfected with a (mouse) LHX1 expression construct (Origene Technologies Inc., Rockville, MD, USA) in which Myc-DDK-tagged-LHX1 is expressed from pCMV6 ...
-
bioRxiv - Cancer Biology 2021Quote: A mouse Nup210 full length cDNA (NM_018815) encoding vector (pCMV6-Nup210-Myc) was purchased from Origene Technologies ...
-
Tumour Extracellular Vesicles Induce Neutrophil Extracellular Traps To Promote Lymph Node MetastasisbioRxiv - Cancer Biology 2023Quote: B16F10 cells were transfected with Rab27a-mouse shRNA and scramble RNA lentiviral particles purchased from Origene according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... a rabbit anti-C.a polyclonal antibody at 25 µg/mL (OriGene) counterstained with a secondary goat anti-rabbit IgG conjugated with Alexa Fluor 555 at 0.4 µg/mL (Invitrogen ...
-
bioRxiv - Physiology 2021Quote: ... Full-length human (RC211179) and mouse GCGR (MR207767) both Myc-DDK-tagged cDNA were obtained from OriGene Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... For chaperone over-expression: either human PDEδ (NM_002601.4; Dharmacon MHS6278-202829730) or mouse UNC119A (NM_005148; Origene RC203758) was cloned in front of a T2A site followed by mCherry to allow for co-translational cleavage and expression ...
-
bioRxiv - Biochemistry 2021Quote: ... The expression vectors for mouse fucosyltransferases (FUTs) and L-Fringe were obtained from Origene (supplemental Fig. S1).
-
bioRxiv - Immunology 2022Quote: ... stable cell lines were produced using commercially designed lentivirus particles targeting mouse Gsdmc2 (NM_001168274.1) and Gsdmc3 (NM_183194.3) (Origene #HC108542): shRNA HC1008542A– AGTATTCAATACCTATCCCAAAGGGTTCG ...
-
bioRxiv - Neuroscience 2022Quote: pCMV6-eEF1A1 (#MG207381) and pCMV6-eEF1A2 (#MG207396) mouse ORF clones (GFP tagged) were obtained from OriGene (USA). They were subcloned into AAV2 (shortened as AAV ...
-
bioRxiv - Developmental Biology 2023Quote: ... we amplified the Sfrp2 coding sequence from an Sfrp2 (NM_009144) Mouse Tagged ORF Clone (Origene CAT#: MR204070) using CloneAmp™ HiFi PCR Premix (Takara 639298 ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids encoding mouse KvS subunits with C-terminal myc-DDK tags were obtained from Origene (Kv6.1 (MR223857); Kv6.4 (MR224440) ...
-
bioRxiv - Genetics 2020Quote: ... cells were fixed and stained with an anti-DDK antibody (OriGene, TA50011), and actin and dapi probes as described for immunofluorescence above ...
-
bioRxiv - Cell Biology 2021Quote: ... the antibodies used were rabbit monoclonal anti-GLI1 (Clone EPR4523, Origene Technologies) at a 1:1000 dilution and anti-Lamin A/C (Cell Signaling Technologies 2032 ...
-
bioRxiv - Microbiology 2020Quote: ... The slides were then incubated with an HRP-conjugated secondary antibody (OriGene) for 20 minutes at RT and stained with DAB (Vector Laboratories) ...
-
bioRxiv - Biochemistry 2022Quote: ... and Rabbit Polyclonal Anti-METTL7A Antibody was obtained from Origene (Rockville, MD). Reagents and materials for cell culture and gene modulation ...
-
bioRxiv - Physiology 2022Quote: ... Flag immunoprecipitation was performed with antibody conjugated-magnetic beads (OriGene, Rockville, MD). The following antibodies were obtained for immunoblotting ...
-
bioRxiv - Neuroscience 2023Quote: ... was then used with an anti-FKBP5 antibody (OriGene, Rockville, MD, USA) at a 1 in 80 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... two different anti-human DSG2 antibodies (DSG2-Origene, #BM5016; DSG2-Abcam, #ab14415) were used at 1:1000 dilutions in blocking buffer ...
-
bioRxiv - Neuroscience 2020Quote: The plasmid encoding AAV-PGK-chst3 was made by amplifying the mouse chst3 sequence from plasmid MR207541 (OriGene) via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593 ...
-
bioRxiv - Biochemistry 2021Quote: ... transiently co-transfected with pcDNA3.1-FIT2/V5-His and GFP-tagged MARCH6 (BC059190) Mouse Tagged ORF Clone (Origene), were pre-treated with 10 µM MG132 (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2020Quote: The mouse YAP1 WT gene with a Myc-tag in the pCMV6 backbone was purchased from Origene (MR226049). YAP S274A and YAP S352A mutants were generated by PCR assembly ...