Labshake search
Citations for Origene Technologies :
151 - 200 of 483 citations for Mouse IgG2a Isotype Control Antibody HOPC 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... The Emory University Integrated Genomics core facility (Atlanta, GA) subcloned mouse and human Esm-1 cDNA from pCMV6 (Origene, Rockville, MD) into pT3 ...
-
bioRxiv - Neuroscience 2019Quote: Four shRNAs against Mus musculus Cyp19a1 and one control scrambled shRNA were obtained from Origene (Rockville; Cat No. TG509276). These plasmids express both shRNA under the control of the U6 promoter and turboGFP under the control of a CMV promoter ...
-
bioRxiv - Immunology 2021Quote: ... Locus ID 5893) and non-effective Trilencer-27 Flurescent-labeled transfection control siRNA duplex (SR30002) were obtained from Origene Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... and scrambled control shRNA cassette in pGFP-V-RS Vector (Cat#TR30013) were purchased from Origene (Rockville, MD, USA). Lipofectamine™ stem transfection reagent (Cat#STEM00003 ...
-
bioRxiv - Cell Biology 2019Quote: ... 5% heat-inactivated goat serum) and incubated with primary antibody (1:1000 anti-DDK monoclonal 4C5; OriGene Technologies) in PBT1 at 4°C overnight ...
-
bioRxiv - Developmental Biology 2021Quote: ... at 56°C for 40min and re-probed with anti–GFP antibody for 1h (1:1000, Origene R1091P). Band intensity was measured using the histogram function on the Fiji software ...
-
bioRxiv - Molecular Biology 2022Quote: ... sharing 91% homology with mouse JPH2 protein) and mouse Jcn cDNA (Accession number: NM_133723, Origene, Rockville, MD, USA) were inserted into pVN155 and pVC155 ...
-
bioRxiv - Cancer Biology 2020Quote: BT088 cells were transduced with 4 SMPD3 human shRNA lentiviral particles (A,B,C,D) and Lenti shRNA Scramble control particles (pGFP-c-shLenti; TL301492V; Origene). Transduced GFP+ cells (shSMPD3-GFP variants B,D and shScrambled-GFP ...
-
bioRxiv - Biochemistry 2022Quote: Lentiviral pGFP-shHKII vector encoding human shRNAHKII (Cat# TL312415) and non-silencing control pGFP-C-shLenti vector (Cat#: TR30023) were purchased from OriGene Technologies Inc (Rockville ...
-
bioRxiv - Cancer Biology 2019Quote: The TDP1 cDNA clone with expression under the control of the CMV promoter in pCMV6-XL4 was obtained from OriGene. H263A substitution was performed using the Q5 Site-Directed Mutagenesis Kit (NEB ...
-
bioRxiv - Genomics 2019Quote: ... Control or CGGBP1-shmiR (targeting 4 different regions in CGGBP1 ORF) or CGGBP1-overexpression lentivirus constructs were obtained from Origene. The third generation lenti-packaging plasmids ...
-
bioRxiv - Molecular Biology 2021Quote: ... CGGBP1 depletion in these cells was achieved by lentiviral transduction of the lentiviral shmiR constructs (four different sites in the ORF) targeting CGGBP1 (KD) or Control-shmiR (CT) obtained from Origene as described earlier (PMID ...
-
bioRxiv - Cell Biology 2022Quote: ... HESCs were transfected with an empty expression plasmid (control) or human KISS1R expression plasmid corresponding to the open reading frame (Origene) or human ESR1 expression plasmids hESR1-46 or hESR1-66 (Flouriot ...
-
bioRxiv - Molecular Biology 2022Quote: ... each well was transfected with 1 μg total dciCas9-VPR and CXCR4 sgRNA plasmids (450 ng dciCas9-VPR, 450 ng CXCR4 sgRNA, 100 ng mCherry control) using Turbofectin (Origene) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... pGFP-C-shLenti scrambled negative control (TR30021), and pGFP-C-shLenti Lphn3 shRNA-D (GTATGTTGGCTTCGCCTTGACACCTACTT, custom) were purchased from Origene.
-
bioRxiv - Immunology 2023Quote: A plasmid vector constitutively expressing the Rorc gene under the control of the CMV promoter (pCMV6-Rorc) (Origene, No. MR222309) was co-transfected with a plasmid expressing the luciferase gene (Luc ...
-
bioRxiv - Cell Biology 2020Quote: ... full length mouse CRMP4 (DPYSL3, Origene 1197294), full length CRMP5 (DPYSL5 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse AUTS2-myc-DDK in pCMV6 (OriGene) and pCGN-His-Ub (His-tagged ubiquitin expression vector ...
-
bioRxiv - Immunology 2023Quote: ... Mouse anti ZFP36 (Origene #OTI3D10, 2μg/ml), rabbit anti ZFP36L1 (CST #BRF1/2 ...
-
bioRxiv - Bioengineering 2024Quote: ... mouse anti-Lhx1 (CF504527, OriGene, RRID: AB_2724601) labeled with Alexa Fluorphore 647 (Novus ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were incubated with a mixture of primary rabbit anti–GFP antibody (1:500; catalog #SP3005P, OriGene, Rockville, MD) and mouse anti–NeuN antibody (1:1000 ...
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... then incubation was undertaken with a primary rabbit polyclonal CSF2RA (GM-CSF receptor alpha) antibody for 1 hour (Origene TA323990S ...
-
bioRxiv - Neuroscience 2021Quote: Membranes were blocked for 1 hour at room temperature with Odyssey blocking buffer (Li-Cor, Lincoln, NE, USA) and were then incubated with mouse anti-TurboGFP (1:2000; Origene, Rockville, MD, USA) and rabbit anti-β-tubulin (1:5000 ...
-
bioRxiv - Neuroscience 2020Quote: pLenti-C-Myc-DDK (control) and human PLCγ2-myc-DDK (WT) in pLenti-C backbone vectors were obtained from OriGene (PS100064, RC200442L1). PLCγ2-myc-DDK was subjected to site-directed mutagenesis (QuikChange Lightning Multi Site-Directed Mutagenesis Kit ...
-
bioRxiv - Pathology 2021Quote: ... Additional positive and negative control experiments were performed in which purified recombinant PBX1 and MEIS2 proteins (purchased from Origene, Rockville, MD) were incubated with the same concentrations of each drug and assayed.
-
bioRxiv - Physiology 2021Quote: ... the pRL-TK renilla luciferase vector as an internal control and varying concentration of a CASR containing a myc tag vector (Origene Inc.). After 24 hr incubation with standard medium containing 1.5 mM calcium the cells were assayed for Cldn14 reporter expression using a luciferase assay system from Pormega Corp ...
-
bioRxiv - Synthetic Biology 2022Quote: ... measuring association by dipping tips in undiluted PTH produced in CFPS and purified as previously described or in 67 μg/ml of a commercially produced positive control PTH (OriGene SA6052) for 180 s ...
-
bioRxiv - Biochemistry 2023Quote: ... the lateral and contralateral tibialis anterior were injected with 30 µg of either control empty vector pCMV6 or Nr2f6-myc-flag overexpression plasmid (Origene, #MR206083) and 220V/cm were applied in 8 pulses of 20/200 ms on/off (ECM 830 Electroporator ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-DDK (4C5) (OriGene Technologies, Rockville, MD). Alexa-594 labeled transferrin ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-ERGIC-53 (clone 2B10, OriGene), rabbit polyclonal anti-ERGIC-53 (E1031 ...
-
bioRxiv - Cell Biology 2022Quote: ... The mouse HSP90AB1 was purchased from Origene (TA500494). All antibodies were used at a dilution of 1:1000 unless otherwise specified ...
-
bioRxiv - Neuroscience 2023Quote: Mouse HAPLN1 cDNA was purchased (Origene, Rockville, MD) and cloned as a fusion to Venus into the pCAGGS mammalian expression plasmid ...
-
bioRxiv - Developmental Biology 2024Quote: ... Lmx1b Mouse Tagged ORF Clone plasmids (ORIGENE, MG226016) were transfected using Lipofectamine LTX Reagent with PLUS Reagent (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... and mouse ALPL (MC228161) were purchased from OriGene. Cynomolgus Macaque (XM_005544525 ...
-
bioRxiv - Genetics 2023Quote: ... Sections were incubated overnight at 4 °C with an anti-Cnn1 rabbit monoclonal primary antibody (1:400 dilution; TA327614; Origene), or a CD68 rabbit polyclonal antibody (1:300 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-KRas antibody (OriGene, mouse monoclonal #CF801672 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... MG87.TRKB cells were transfected with a mix of 4 AP2M specific shRNA sequences (#TG712191, Origene, USA or scrambled sequence as control) using Lipofectamine 2000 (#11668019 ...
-
bioRxiv - Cancer Biology 2021Quote: ... siRNA oligo duplex of Locus ID 2932 (SR301979) and scrambled negative control siRNA Duplex siRNA (SR30004) were purchased from Origene (Rockville, MD).
-
bioRxiv - Cell Biology 2020Quote: ... or FLAG-mNUP153 (mouse) expression vectors were constructed by amplifying full length human NUP153 or mouse NUP153 cDNA using human NUP153 cDNA (Origene, SC116943) or mouse NUP143 cDNA (ATCC ...
-
Development of immortalized rhesus macaque kidney cells supporting infection with a panel of virusesbioRxiv - Microbiology 2022Quote: ... After removing the supernatant cells were stained with a rat anti-podoplanin antibody (1:100; Origene AM01133PU-N, Rockville, MD, USA) or no antibody in a volume of 50 μl for 30 min on ice ...
-
bioRxiv - Microbiology 2024Quote: ... S1PR2 expression in J2 HIEs was detected by Western blot analysis using rabbit S1PR2 polyclonal antibody (1:500; #AP01198PU-N, OriGene Technologies). Villin was used as cell loading control and detected using 1:1000 dilution of mouse anti-villin (#sc-373997 ...
-
bioRxiv - Cancer Biology 2020Quote: A Myc-DDK-tagged ORF clone of TCF4 and the negative control pCMV6 were used for in transient transfection (RC224345; OriGene, Rockville, Maryland, USA) using previously described methodology 37 ...
-
bioRxiv - Cell Biology 2021Quote: ... Each well received 100 ng of the pMIR-REPORT™ Luciferase vector containing the 3’UTR-hTLR4 (without a negative control) in combination with 1µg pCMV-MIR or pCMV-pre-mir125b1 (OriGene Technologies, Rockville, Maryland, USA) or let7A2 generated in the laboratory and with 50 ng of pRL-TK Renilla luciferase plasmid (Promega). ...
-
bioRxiv - Pathology 2023Quote: Human astrocytes used co-culture were first transduced with lentiviruses carrying GFP (LentiORF control particles of pLenti-C-mGFP-P2A-Puro Origene™ cat# PS100093V), CLU (Lenti ORF particles ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-desmoglein-2 mouse monoclonal (Origene, Rockville, MD, USA), anti-E-cadherin mouse monoclonal (BD ...
-
bioRxiv - Developmental Biology 2019Quote: A mouse KLF4-GFP vector (RG206691) obtained from Origene and KLF4(S132A)-GFP mutant published in Dhaliwal et al ...
-
bioRxiv - Microbiology 2019Quote: ... Mouse G3BP1 was subcloned from pCM6-G3BP1 (MR207441; Origene). Mouse G3BP1 lentiviral constructs deficient in the C-terminal RGG domain (mG3BP1ΔRGG ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNAs (27mers) targeting mouse PURB were purchased from ORIGENE, and siRNA transfection was done using Lipofectamine 2000 following the manufacture’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse anti-Myc-tag (9E10) was purchased from Origene; Rabbit anti-GM130 was purchased from Abcam ...
-
bioRxiv - Immunology 2020Quote: ... Mouse anti-Myc (9E10) Ab was from Origene (USA); Rabbit anti-GM130 was from Abcam (United Kingdom) ...