Labshake search
Citations for Origene Technologies :
51 - 100 of 483 citations for Mouse IgG2a Isotype Control Antibody HOPC 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... or empty control (Origene, Rockville MD, Ref: PS100001) expression vector for 36 h ...
-
MIIP downregulation promotes colorectal cancer progression via inducing adjacent adipocytes browningbioRxiv - Cancer Biology 2023Quote: ... Human CD36 or control shRNA constructs (Origene, TR314090) were transfected into parental HCT116 cells using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... or shScramble sequence as control (OriGene, cat.#TR30021). Constructs co-expressed GFP ...
-
bioRxiv - Cancer Biology 2023Quote: ... or shScramble sequence as control (OriGene, cat.#TR30033). Constructs co-expressed RFP ...
-
bioRxiv - Neuroscience 2023Quote: ... or a pCMV EV control (catalogue # PS100001, OriGene)) were grown in chemically competent DH5α E ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Klf5 antibody (1:100, TA811868, Origene), anti-Bmp7 antibody (1:100 ...
-
bioRxiv - Cancer Biology 2020Quote: Control cell plugs were made by transfecting PC3 cells with C-kit Variant 1 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies used: YFP Goat polyclonal antibody (1:500) (ORIGENE, Cat.No. AB1166-100), mouse mCherry antibody (Thermo Fisher ...
-
bioRxiv - Cell Biology 2020Quote: ... siERCC8 (5′-GGAGAACAGAUAACUAUGCUUAAGG −3′) and siRNA duplex control (Origene) was diluted with DMEM to a final concentration of 20□nM ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells transfected with nonspecific control siRNA (SR30004, OriGene, USA) were used as the control ...
-
bioRxiv - Cancer Biology 2020Quote: ... and the pVector control vector (OriGene Technologies Cat# PS100093) were used to generate the ES8-KO+OE ...
-
bioRxiv - Cell Biology 2023Quote: ... or control or GCN5L1 ORF lentiviral particles (Origene, USA), followed by puromycin selection ...
-
bioRxiv - Cell Biology 2020Quote: ... with primary antibodies against Trim39 (Origene, 1:400) and NFATc3 (Proteintech ...
-
bioRxiv - Biochemistry 2022Quote: ... Primary antibodies (PANK1 CST 1:1000; PANK2 Origene 1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... CRHR2 antibody (1:1000, ORIGENE, rabbit, AP17244PU-N), Grin2B antibody (1:1000 ...
-
bioRxiv - Biochemistry 2023Quote: ... and rabbit anti-mKate2 antibodies (1:2000, Origene). The protein bands were obtained using horseradish peroxidase-conjugated antibodies against mouse whole immunoglobulins and horseradish peroxidase-conjugated antibodies against rabbit whole immunoglobulins (1∶10,000 ...
-
bioRxiv - Microbiology 2021Quote: ... The lentivirus contained the human ACE2 gene under control of the CMV promoter along with green fluorescent protein (GFP) also under control of a separate CMV promoter (Origene Technologies, Rockville, MD). A MOI of 20 was used for lentivirus transduction ...
-
bioRxiv - Cancer Biology 2020Quote: ... was purchased from Sigma Aldrich and mouse anti-PDLIM2 Ab (1:250) was purchased from Origene. Rabbit anti-FAK Abs (1:500) ...
-
bioRxiv - Cell Biology 2019Quote: ... and mDia2 shRNA and control pGFPVRS from Origene (Rockville, MD) respectively.
-
bioRxiv - Molecular Biology 2022Quote: ... cells were transiently transfected with control siRNA duplex (OriGene #SR30002) and two Stealth siRNAs targeting ELP3 (ELP3 siRNA1(OriGene#SR310519A ...
-
bioRxiv - Cell Biology 2022Quote: Specific siRNA oligo duplexes and Control siRNA (Origene, USA, SR30004) were complexed with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... scramble (control) siRNA (30nM; OriGene Technologies, Inc. MD, USA, USA), and pmaxGFP (0.5 ug ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mouse monoclonal anti-ZsGreen1 (ZSG) clone TI2C2 (1:2000) (OriGene, Cat#: TA180002); Mouse anti-capsid (1:3000 ...
-
bioRxiv - Cell Biology 2020Quote: Mouse Add1 cDNA transcript variant 1 was purchased from Origene (Cat# MR210357). The Add1 gene was amplified and subcloned into pUC19 for point mutations by the GeneArt Site-Directed Mutagenesis Plus Kit (Life Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... and mouse TMEM87A -transcript variant 1 (NM_173734; MC201598) were purchased from Origene. The coding sequences of these genes were PCR amplified and then subcloned into CMV-pIRES2-DsRed/iRFP vector using the SalI/BamHI restriction enzyme sites or CMV-EGFP-N1 vector using the EcoRI/AgeI restriction enzyme sites using the cloning kit (EZ-Fusion™ HT Cloning core Kit ...
-
bioRxiv - Immunology 2023Quote: ... and mouse anti-GAPDH monoclonal IgG (Origene TA802519, clone OTI2D9, 1:2000). Secondary antibodies were donkey anti-rabbit IgG (Alexa Fluor 790 ...
-
bioRxiv - Biochemistry 2020Quote: Viral vectors expressing lentiviral particles with 4 unique 29mer target-specific shRNA (A/B/C/D) to murine PRDX4 and 1 scramble control (non-specific or NS) were purchased from Origene (Rockville, MD). MIN6 cells were seeded on 48 well plates and cultured overnight in 0.3 mL medium ...
-
bioRxiv - Cell Biology 2019Quote: ... Control cells were generated using empty pGFP-V-RS vector (Origene). Cells were then further selected for GFP through flow cytometry using the FACS Aria Ilu High-Speed Cell Sorter (BD Biosciences (Franklin Lakes ...
-
bioRxiv - Neuroscience 2022Quote: ... Scrambled shRNA control in pGFP-V-RS shRNA Vector (TR30013, Origene); Smoothened shRNA in pGFP-V-RS shRNA Vector (TG510788 ...
-
bioRxiv - Neuroscience 2021Quote: ... were applied and scrambled shRNA was used as control (OriGene, #TR30021). For overexpression experiments ...
-
bioRxiv - Neuroscience 2022Quote: Pre-designed control and Mettl3-targetting siRNAs were purchased from Origene, control and Mettl3-targeting LNA GAPmers were designed and purchased from Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... were used to transfect pCMV6-Entry Mammalian Expression control (PS100001, Origene) and Human Dlk2 pCMV6 (RC210622 ...
-
bioRxiv - Cell Biology 2020Quote: ... or α-CD68 (1:2000, mouse monoclonal, clone BM4000, OriGene Technologies, Rockville, USA). An α-mouse ...
-
bioRxiv - Cancer Biology 2023Quote: ... and anti-LGR5 mouse monoclonal conjugated with PE at 1:100 (Origene #TA400001). Apart from the LGR5 antibody incubation (of 20 minutes) ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-GAPDH antibody (TA802519) is from Origene (WB-1:5000), anti-HA antibody (C29F4 ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies used were hnRNPM (Origene technologies, TA301557, 1:50,000), GAPDH (EMD Millipore ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... siRNA targeting GM130 and scrambled negative control siRNA were purchased from OriGene. For siRNA treatments ...
-
bioRxiv - Neuroscience 2020Quote: ... and a scramble control were obtained from Origene (CAT#: KN216443 and KN202921RB). Target sequences were flanked with specific homology sequences for the stable integration of donor sequences ...
-
bioRxiv - Biochemistry 2021Quote: ... The eluted fraction was then subjected to immunoblotting assay and MARCH6 was detected using Mouse monoclonal turboGFP antibody (Origene).
-
bioRxiv - Genetics 2019Quote: ... Shox2 (Myc-DDK-tagged) and Control (Myc-DDK-tagged) were purchased from Origene. To transduce the ATDC5 cells ...
-
bioRxiv - Molecular Biology 2022Quote: siRNA duplexes targeting TIPARP and Universal scrambled negative control were purchased from Origene and transfected into SGBS cells using Lipofectamine RNAiMAX reagent (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... and turboGFP (tGFP)-tagged human CAPRI and control tGFP alone were from OriGene Inc ...
-
bioRxiv - Immunology 2022Quote: ... HC108542B–AGTTGTGTTGTCCAGTTTCCTGTCCATGC and scrambled negative control non-effective shRNA (Origene Item no: TR30023). Lentivirus was packaged by co-transfecting shRNA and psPAX2 and pVSVG packaging plasmids into HEK293T cells ...
-
bioRxiv - Developmental Biology 2021Quote: ... The primary antibodies used were: rabbit anti-GFP (1:500; Origene TP401), mouse anti-GFP (1:500 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The primary antibody anti-DDK (FLAG®) (OriGene Technologies, TA50011, 1:1000) was used for detection of proteins overexpressed from the pCMV6-entry vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... The following primary antibodies were incubated overnight: TRIM24 (1:200, TA802797, Origene), TRIM33 (1:200 ...
-
bioRxiv - Neuroscience 2024Quote: ... or a dilution of 1/1,000 anti-turboGFP chicken antibody (Origene; TA150075) respectively ...
-
bioRxiv - Bioengineering 2024Quote: ... Primary antibodies pan cytokeratin (PanCK, 1:100, OriGene Catalog # CF190032, Lot # F003) and vimentin (VIM ...
-
bioRxiv - Molecular Biology 2022Quote: ... or mouse MSS51-Myc-FLAG (mouse cDNA clone; Origene MR217897) using Lipofectamine 2000 as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... the slides were washed three times with PBS and incubated with secondary antibodies (hypersensitive enzyme-labeled goat anti-mouse/rabbit IgG polymer (OriGene, China) at room temperature for 20 min ...