Labshake search
Citations for Origene Technologies :
351 - 400 of 612 citations for Carboxypeptidase Y from Baker's Yeast since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: Human STING and SURF4 were subcloned from HEK293T cDNA into pCMV6-AC (Origene) with a FLAG tag at the C-terminus or a HA tag at the N-terminus ...
-
bioRxiv - Immunology 2021Quote: Short hairpin RNA targeting TRIF and MYD88 (shTRIF, shMYD88) were purchased from OriGene Technologies (Rockville ...
-
bioRxiv - Immunology 2020Quote: ... and turboGFP (tGFP)-tagged human CAPRI and control tGFP alone were from OriGene Inc ...
-
bioRxiv - Immunology 2020Quote: ... The human MSR1 (Cat# RC209609) were obtained from Origene (Rockville, MD 20850, USA). Human MSR1 and its fragment 1-50 ...
-
bioRxiv - Molecular Biology 2023Quote: ... as well as a (Myc-DDK-tagged)-empty vector were purchased from OriGene. Anti-zyxin antibody was from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primers targeting beta-Actin (ACTB) (NM_001101) were obtained from Origene (Cat. No. HP204660) and included as the reference gene ...
-
bioRxiv - Microbiology 2023Quote: AREG: 5’-GCACCTGGAAGCAGTAACATGC-3’ (Fwd) and 5’-GGCAGCTATGGCTGCTAATGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD3: 5’-AGGCAGTAGATGTGCGCCAGAT-3’ (Fwd) and 5’-TCCTGGATGGTGCTGTTGAGGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD1: 5’-CCTGGCTATCTATCCACCATGTG-3’ (Fwd) and 5’-TTCTGGTCCTCGTCTTGCCTGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9L: 5’-CCGCTCTACCACAATGCCATCA-3’ (Fwd) and 5’-CTGAGTTCAGGTGCATCTGGCT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Biochemistry 2023Quote: ... a Myc- DDK tagged LRPPRC ORF plasmid was obtained from OriGene (CAT: RC216747). This ORF was then subcloned into a hygromycin resistance-containing pCMV6 entry vector (OriGene ...
-
bioRxiv - Cancer Biology 2023Quote: The Colon Cancer Tissue cDNA Array IV panel (HCRT104) was purchased from Origene Technologies (Origene Technologies Inc. ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmid encoding human DGKε (hDGKε, NM_003647) was purchased from OriGene (cat. No. RC219913). The DGKE coding sequence was subcloned into the pcDNA3.1/Hygro(+)-2xMyc vector using primers ...
-
bioRxiv - Molecular Biology 2023Quote: The c-Myc tagged human Gab1 cDNA clone (RC209622) was purchased from Origene, USA ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: Full-length human dystroglycan cDNA in CMV-6 plasmid was obtained from Origene and used as a template for all of the cloning ...
-
bioRxiv - Cancer Biology 2023Quote: ... Galectin-3-binding protein ORF was subcloned from its source vector (Origene # RC204918) into bicistronic lentiviral transfer vector pHR-CMV-TetO2 3C-TwinStrep-IRES-EmGFP vector (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... and MK5 specific shRNA construct in lentiviral GFP vector were purchased from Origene (Rockville ...
-
bioRxiv - Cell Biology 2022Quote: ... and pCMV6 Entry Vector plasmid (pCMV6-EV) (catalog #: PS100001) were obtained from Origene. The missense mutations (A322D ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-tagged mouse Suv39h1 (NM_011514) was purchased from Origene (#MG206488; Rockville, MD, USA). pEGFP-C1-human SUV39H1 was previously described [7] ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse Pla2g2a-Myc-DDK construct was obtained from Origene (m-sPLA2-IIA-myc). Mouse PGRN construct was cloned into pSecTag2B vector (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... and pCMV6 Entry Vector plasmid (pCMV6-EV) (catalog #: PS100001) were obtained from Origene. The human GABAA receptor α1 subunit missense mutations (S76R ...
-
bioRxiv - Microbiology 2023Quote: AMOTL2: 5’-AGTGAGCGACAAACAGCAGACG-3’ (Fwd) and 5’-ATCTCTGCTCCCGTGTTTGGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9: 5’-TCCAGCTCGTTCTCCCAACTTG-3’ (Fwd) and 5’-GATTGGAGTGAGAAAGTGGCTGG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Microbiology 2023Quote: RPLP0: 5’-TGGTCATCCAGCAGGTGTTCGA-3’ (Fwd) and 5’-ACAGACACTGGCAACATTGCGG-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: PYGO1: 5’-GGTTAGGAGGACCAGGTGTACA-3’ (Fwd) and 5’-AGCAGCCACTAGATGGTCAGAG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Genomics 2024Quote: ... Scrambled guides for both CRISPRa (cat # GE100077) and CRISPRi (cat # GE100086) from Origene Tech were included as controls ...
-
bioRxiv - Genomics 2024Quote: ... the guides were cloned into the respective CRISPRa and CRISPRi vectors from Origene Tech (CRISPRa vector has a tGFP reporter ...
-
bioRxiv - Microbiology 2024Quote: ... Flag-TRIM7 constructs Variant 1 and 2 were purchased from Origene (Rockville, MD), the Flag-OTU and -OTU2A were kindly provided by Adolfo Garcia-Sastre (Mount Sinai) ...
-
bioRxiv - Neuroscience 2024Quote: The DHCR7 plasmid (catalog number RC200480) was obtained from Origene (Rockville, MD, USA). To create the spEGFPKDEL-P2A-DHCR7 plasmid ...
-
bioRxiv - Cell Biology 2020Quote: ... Bmf-specific shRNA plasmids and control plasmids were purchased from OriGene (OriGene Technologies, Inc.) and were packaged into retroviral particles using Phoenix cells as specified by the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... The CatSper1 ORF was amplified from a mouse cDNA clone (Cat. No. MR224271, Origene). C2cd6s was subcloned into pcDNA3.1/myc-His A vector (Cat ...
-
bioRxiv - Genomics 2020Quote: Human full-length INTS6 ORF in pCMV6-entry vector was purchased from Origene (RC208036). The INTS6 ORF was PCR amplified with 5’ Xho I and 3’ EcoRI restriction site overhangs and the coding sequence for a C-terminal V5 epitope tag was added in frame to the 3’ end of the INTS6 ORF (Key Resources Table ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mutant PES1 (#CW306514) and POLR2K (#CW306515) 3’UTR clones were all purchased from Origene. Mutant 3’UTR plasmids were generated by synthesizing 3’ UTR sequences in which the three GCCCCC seed matches in the 3’ UTR of PES1 and one in 3’ UTR of POLR2K was each changed to TGCAAA and this altered sequence was each inserted into the pmiRTarget construct by Origene ...
-
bioRxiv - Neuroscience 2021Quote: The pCMV6-Arc-Myc-DDK (FLAG) mouse ORF cDNA clone (MR206218) was from OriGene Biotechnologies (Rockville ...
-
bioRxiv - Physiology 2021Quote: ... which was obtained by PCR from plasmid pCMV6-EIF2A-GFP (MG209105, OriGene, Rockville, MD) using forward primer 5’-ATTCGTCGACTGGATCCGGT-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs constructs targeting human or mouse ATRX were obtained from OriGene (Rockville, MD, USA). The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid DNA with complementary DNA sequences for human mtDNA was obtained from ORIGENE (SC101172). Concentrations were converted to copy number using the formula ...
-
bioRxiv - Immunology 2022Quote: ... Human MR1 transcript variant 1 (NM_001531) cDNA clone was purchased from Origene (Rockville, MD). The constructs were then cloned into a lentiviral expression vector with a multiple cloning site separated from GFP reporter via an Internal Ribosomal Entry Site (IRES ...
-
bioRxiv - Neuroscience 2020Quote: ... Gstp2 and Gstp3 cDNA clones in the pCMV6-Entry vector were purchased from Origene (MR202273 ...
-
bioRxiv - Molecular Biology 2020Quote: ... China) and Native ORF cIAP-2 clone in pCMV vector was purchased from Origene, Rockville ...
-
bioRxiv - Cell Biology 2020Quote: ... and human pCMV6-KLHL41-Myc-DDK (RC200295) were purchased from Origene (Rockville, MD, USA). The control (D-01910-10-50) ...
-
bioRxiv - Biochemistry 2021Quote: METTL5 coding sequence was amplified from pCMV-Entry-METTL5-Myc-DDK (Origene cat# PS100001) by PCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cryopreserved normal human kidney and tonsil tissue blocks were purchased from Origene (Rockville, MD).
-
bioRxiv - Microbiology 2020Quote: Plasmids encoding TMPRSS2 and the control empty vectors were purchased from OriGene (SC323858, PS100020). DNA sequence of SARS-CoV-2 S protein (GenBank YP_009724390 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human C-terminally Myc-FLAG-tagged ZDHHC20 (C-FLAG-D20) was purchased from Origene Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... The wild-type human genes mS25 and bS16m were obtained in plasmids from OriGene. Mutations of cysteine/s in bS16m and mS25 coordinating Fe-S clusters to alanine ...
-
bioRxiv - Genomics 2024Quote: ... a plasmid containing the sequences for NY-ESO-1 (CTAG1B) was ordered from OriGene Technologies ...
-
bioRxiv - Genetics 2023Quote: ... The xiap- and p47-donor DNA used in CRISPR experiments were procured from Origene technologies with a customized RFP-Puro cassette ...
-
bioRxiv - Cancer Biology 2024Quote: ... MA) and antibodies against tdTomato and Ki-67 were obtained from Origene (Rockville, MD) and Abcam (Boston ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti-C-Myc-DDK-P2A-Puro Lentiviral Gene Expression Vectors were acquired from Origene (NPEPPS RC209037L3 ...