Labshake search
Citations for Origene Technologies :
201 - 250 of 612 citations for Carboxypeptidase Y from Baker's Yeast since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Crohn’s and ulcerative colitis cDNA arrays were purchased from Origene Technologies (catalog #CCRT102 ...
-
bioRxiv - Physiology 2023Quote: Constructs for Fis1 and Drp1 siRNAs were acquired from Origene (Rockville ...
-
bioRxiv - Biophysics 2023Quote: ... Primary anti-DDK immunoglobulin [TA50011-100] was obtained from OriGene Technologies Inc ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse Myc-RIP2 and Myc-TRAF6 were obtained from Origene. All high-fidelity PCR was performed using NEB Q5 polymerase and all subcloning was done using NEBuilder HiFi DNA Assembly (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... siCOP1 and shRNAs against Cul9 and ATG5 were from Origene, shCOP1 was from Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2023Quote: FLAG-tagged wild type AMOTL2 (NM_016201) was obtained from Origene. Codon-optimized sequences encoding truncated ...
-
bioRxiv - Immunology 2023Quote: Normal lung tissue slides were purchased from Origene (Rockville, MD) and used as controls ...
-
bioRxiv - Cancer Biology 2024Quote: ... Anti-DDK (OTI2F7, catalog number TA500288) was purchased from OriGene Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: Two PEG3-targeting shRNAs were obtained from Origene (https://www.origene.com). JEG-3 cells (1×105 ...
-
bioRxiv - Cell Biology 2024Quote: The AAV plasmid for IF1 overexpression was acquired from Origene Technologies GmbH (Reference CW309970) ...
-
bioRxiv - Neuroscience 2024Quote: ... The FLAG-tagged Zbtb7a construct was purchased from Origene (RC222759).
-
bioRxiv - Cancer Biology 2024Quote: ... siRNA duplex Control scramble and FAT2 siRNAs (all from Origene) were diluted in OptiMEM and mixed with Lipofectamine RNAiMAX transfection reagent at half the manufacturer recommended concentration ...
-
bioRxiv - Cell Biology 2024Quote: Myc-tagged murine NHSL2 (NM_001163610) was purchased from Origene (MR223518) and was used to clone full length murine NHSL2 ...
-
bioRxiv - Cancer Biology 2024Quote: Colon cancer cDNA Array was purchased from Origene (Cat#: HCRT104). For normal colon tissue used in the CRC cell array ...
-
bioRxiv - Cancer Biology 2024Quote: ... The human IDI-1 (RC214341) gene was purchased from OriGene Technologies and cloned into pMXs-IRES-puro retroviral expression vector (Cell Biolabs) ...
-
bioRxiv - Developmental Biology 2024Quote: Human WNT11 (HWNT11-pCMV6-Entry) was obtained from OriGene (#RC219688) (matching ENST00000322563.8 ...
-
bioRxiv - Neuroscience 2021Quote: Plasmid encoding for ABI3 (NM_016428) was purchased from OriGene (Catalog# RC202853). Site directed mutagenesis in ABI3 was performed and resulting clones were Sanger sequenced to confirm the presence of mutation ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pCMV6-Pdcd7-Myc plasmid was obtained from Origene (OriGene, #MR214517).
-
bioRxiv - Cancer Biology 2022Quote: A plasmid containing the hAHRWT sequence was purchased from Origene (RC209832). The Q383H point mutation was introduced with site-directed mutagenesis with forward primer cattgtaactcacagaccactaacagatg and reverse primer gttagtggtctgtgagttacaatgatataatc ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... CAMK2A in dcSSc fibroblasts was overexpressed using CAMK2A vectors from Origene. 0.1 μg/ml of CAMK2A vector was mixed with Lipofectamine 2000 ...
-
bioRxiv - Genetics 2020Quote: Mouse expression plasmids containing cDNA encoding Rhbdf1 was obtained from OriGene. The Q5® Site-Directed Mutagenesis Kit was used to introduce site-specific mutations in the mouse Rhbdf1 plasmid according to the manufacturer’s instructions and confirmed by Sanger sequencing ...
-
bioRxiv - Neuroscience 2021Quote: ... a CMV promoter driven rat RTN3 plasmid was purchased from Origene, Rockville ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA clone for Cap1 was purchased from Origene (CAT#: MR207594) and subsequently cloned into lentiviral vector pLVX-puro (Clontech ...
-
bioRxiv - Cancer Biology 2020Quote: ... was purchased from Sigma Aldrich and mouse anti-PDLIM2 Ab (1:250) was purchased from Origene. Rabbit anti-FAK Abs (1:500) ...
-
bioRxiv - Genetics 2020Quote: ... GJB2 (NM_004004) Human Tagged ORF Clone was purchased from OriGene (RC202092) and Cx30-msfGFP was purchased from Addgene (69019).
-
bioRxiv - Immunology 2021Quote: NLRP1 and CARD8 transcript variant 1 DNA obtained commercially from Origene (pCMV6-entry clones RC216481 and RC230245 ...
-
bioRxiv - Microbiology 2021Quote: ... and the corresponding empty pLenti-Flag vector were purchased from Origene. HA-tagged TASOR are expressed from the pAS1b vector ...
-
bioRxiv - Microbiology 2020Quote: The cDNA molecules of ADAP2 and LY6E were purchased from OriGene (Cat ...
-
bioRxiv - Microbiology 2020Quote: ... and dipeptidyl peptidase-4 (DPP4) cDNA clones were obtained from Origene, and cloned into a pcDNA3 vector (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... the OSTM1-Myc insert from pCMV6-OSTM1-MYC-FLAG (RC209871, Origene) was amplified by PCR using forward primers (OSTM1 ...
-
bioRxiv - Cell Biology 2021Quote: ... CLIP-RAMP2 [cloned in-house and sequence-verified from RAMP2 (Origene) and CLIP-β2-AR (a gift from Professor Davide Calebiro ...
-
bioRxiv - Cell Biology 2021Quote: ... Snx1-turboGFP and Ccz1-myc were from Origene (#RG201844 and RC222195). GFP-Rab7a was generated by substituting mApple in the Rab7a plasmid with GFP from GFP-Rab11a using NheI and XhoI restriction sites.
-
bioRxiv - Cell Biology 2022Quote: ... and pCMV6 Entry Vector plasmid (pCMV6-EV) were obtained from Origene. The human FLAG-tagged EMC3 plasmid was purchased from GenScript (catalog # ...
-
bioRxiv - Neuroscience 2022Quote: Short interference mouse PCBP1 RNAi plasmids were purchased from Origene (TL502540). Lentiviral particles expressing the PCBP1 shRNAi or scramble control were produced by the VirusTech Core Facility ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mouse Pygo2 and Kit were subcloned from the original vectors (OriGene Technologies ...
-
bioRxiv - Biochemistry 2022Quote: ... and PCYT1B (UniProt KB: Q811Q9) recombinant proteins were purchased from Origene. In bacterial expression plasmids for His6-tagged PCYT2β (Uniprot KB ...
-
bioRxiv - Developmental Biology 2022Quote: A panel of 20 normal human tissues was purchased from OriGene Technologies (Rockville ...
-
bioRxiv - Neuroscience 2021Quote: ... a CMV promoter driven rat RTN3 plasmid was purchased from Origene, Rockville ...
-
bioRxiv - Cell Biology 2021Quote: ... The DNPEP and ENPEP proteins were purchased from OriGene (Cat#: TP300104) and Novus Biologicals (Cat# ...
-
bioRxiv - Physiology 2020Quote: ... hCALHM1 (RC206902) and hCLAHM3 (RC25514) were purchased from ORIGENE (Rockville, MD). All constructs were transfected into HEK293 cells using a TurboFect transfection reagent (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Climp-63-Myc plasmid was acquired from Origene (catalog no: MR215622). The plasmid was transfected into Hepa 1-6 and Cos-7 cells using lipofectamine LTX overnight in OptiMEM media and the experiments were done after 36-48h after transfection.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Mammalian overexpression plasmids and siRNA were purchased from Origene (Rockville, MD). HepG2 and HeLa cells were obtained from ATCC (Manassas ...
-
bioRxiv - Biochemistry 2020Quote: The gfpt2 gene was amplified from pCMV6-AC plasmid (Origene, USA) by PCR and inserted into bacterial expression plasmid pET23a (Novagen ...
-
bioRxiv - Biochemistry 2021Quote: All shRNA constructs for MICS1 and LETM1 were obtained from Origene Technologies (Rockville ...
-
bioRxiv - Immunology 2020Quote: ... The human pCMV6-AC-AQP9-GFP expression vector was from Origene. 30% H2O2 solution ...
-
bioRxiv - Biochemistry 2022Quote: The mouse Phf8 transcript (NM_177201) was purchased from Origene (Cat#: MR223276) and subcloned into a pENTR/D-TOPO vector (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... Frataxin plasmid (pCMV6-FXN-Myc-FLAG) was purchased from Origene (RC204880). The lentiviral 4xGFP11-SEC61B plasmid (pHAGEF2-EF1a-4xGFP11-SEC61B-IRES-Hygro ...
-
bioRxiv - Biochemistry 2022Quote: ... and METTL7B-pCMV6 expression vectors were sourced from Origene (Rockville, MD); Dulbecco′s Phosphate Buffered Saline ...
-
bioRxiv - Cancer Biology 2022Quote: ... The human TEAD4 constructs were purchased from Origene (https://www.origene.com/; RC219686). TEAD4 full length and deletion constructs were amplified by PCR and the PCR products were sub-cloned in to a pcDNA3.1-FLAG vector ...
-
bioRxiv - Neuroscience 2022Quote: Pre-designed control and Mettl3-targetting siRNAs were purchased from Origene, control and Mettl3-targeting LNA GAPmers were designed and purchased from Qiagen ...