Labshake search
Citations for Origene Technologies :
551 - 600 of 612 citations for Carboxypeptidase Y from Baker's Yeast since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... we obtained a clone expressing full-length (residues 1-1106) untagged GLI1 in the pCMV6-XL5 vector backbone from OriGene Technologies (catalog number SC125780) ...
-
bioRxiv - Molecular Biology 2021Quote: ... CGGBP1 depletion in these cells was achieved by lentiviral transduction of the lentiviral shmiR constructs (four different sites in the ORF) targeting CGGBP1 (KD) or Control-shmiR (CT) obtained from Origene as described earlier (PMID ...
-
bioRxiv - Microbiology 2020Quote: ... hnRNPUL1 (NM_007040) and PEG10 (NM_015068.3) were PCR amplified from ORF clones (hnRNPL, GenScript #OHu14072; hnRNPUL1, Origene #RC200576; PEG10, GenScript #OHu101111) and the products were cloned into the mammalian expression plasmid pCAGGS ...
-
bioRxiv - Developmental Biology 2021Quote: A synthetic DNA construct encoding mouse ACVR1 with the R206H mutation (G to A at nucleotide position 617) was assembled from synthetic oligonucleotides and PCR products and cloned into the pCMV6 entry mammalian expression vector (Origene), which also encodes a neomycin resistance marker ...
-
bioRxiv - Cell Biology 2024Quote: ... pLenti-C-Myc-DDK (RC210158L1; carrying the ORF of human CX36; GJD2; NM_020660) was obtained from Origene (Rockville, Md, USA).
-
bioRxiv - Neuroscience 2024Quote: ... Louis, MO) (96, the C-terminal HA-tagged ERα was constructed from the purchased ERα cDNA expression clone (Origene #MG227304) into BamHI and EcoRI sites of pcDNA3 vector using PCR amplification ...
-
bioRxiv - Cell Biology 2023Quote: ... transient or tetracyclin-inducible expression of human HEATR5B with an N-terminal GFP tag in human cells) were cloned by Gibson assembly with the full-length human HEATR5B open reading frame (derived from plasmid RC22610 (Origene)) and either pcDNA3.1-eGFP-linker or pcDNA5-FRT/TO-eGFP-linker plasmids (coding for eGFP and a GGSGGSGG linker ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gRNA sequence CTAGAGGAGGAGATCCCGTC (TGG) in exon 1 of ABI1 was cloned into a pCas-Guide-EF1a-GFP vector (cat. #: GE100018) from Origene Technologies (Rockville ...
-
bioRxiv - Cell Biology 2022Quote: ... 8 mg total membranes (see above) obtained from HeLa cells transiently transfected with either empty vector or untagged PARP12 (#SC112439, Origene) were used in ADP-ribosylation assays ...
-
bioRxiv - Cell Biology 2023Quote: ... The coding open reading frame of EIF2B5 from the pCMV6-AC-tGFP vector was cloned into an empty pCMV6-AC-mGFP (#PS100040, OriGene) and empty pCMV6-AC-mRFP (#PS100034 ...
-
bioRxiv - Cell Biology 2023Quote: ... pGFP-C-shLenti scrambled negative control (TR30021), and pGFP-C-shLenti Lphn3 shRNA-D (GTATGTTGGCTTCGCCTTGACACCTACTT, custom) were purchased from Origene.
-
bioRxiv - Cell Biology 2023Quote: ... ATAGAGCGTGCGGATAATGACAAGGAGTA), Synaptojanin 2 shRNA in pRFP-C-RS vector (cat. no. FI732825, TGTGCCTCTGCGGCAGCACCAGGTGAACT and FI732826, TTGTGGAGACAGAGCAGGCGATTTACATG) were purchased from Origene. Constructs of the following proteins were kind gifts ...
-
bioRxiv - Cell Biology 2023Quote: ... Golgin-45-HA-MAO was generated by >90% of the cell population was further confirmed through flow Gibson assembly using the HA-MAO vector digested with NheI/KpnI and golgin-45 cDNA (missing its C-ter, amino acids 1 to 368) purchased from Origene.
-
bioRxiv - Cancer Biology 2023Quote: ... A sample of human CRC hepatic metastasis (#CB522586, 44 years old male) with clear tumor-liver borders was selected from a commercial biobank (Origene). Non-consecutive sections were cut with a thickness of 10μm and placed onto 2 capture areas of 10X Visium Spatial Gene expression slide using a cryostat (Leica CM3050S) ...
-
bioRxiv - Biochemistry 2023Quote: Plasmid pCMV6 encoding cDNA for human RHBDL2 and RHBDL4 with a C-terminal myc-FLAG tag was obtained from OriGene, USA ...
-
bioRxiv - Neuroscience 2023Quote: ... RC210883L4), EP3 (pLenti-PTGER3-mGFP-P2A-Puro, RC220173L4) and EP4 (pLenti-PTGER4-mGFP-P2A-Puro, RC210932L4) were purchased from OriGene Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... GFP-tagged-RADIF was obtained by restriction digestion from Lenti-Myc-FLAG-RADIF using AsiSI and MluI and cloning into a pCMV6-AC-GFP vector originally obtained from Origene. gRNA-target-resistant constructs were generated by site directed mutagenesis using QuikChange II Site-directed mutagenesis kit (200521 ...
-
bioRxiv - Cancer Biology 2024Quote: USP39 (NM 006590) human mGFP-tagged ORF clone lentiviral particles (RC209551L4V) and control lentiviral particles (PS100093V) were purchased from OriGene.
-
bioRxiv - Genomics 2024Quote: Human TOP3A-Myc-FLAG cDNA ORF (CAT#: RC208236) and human TOP3B-Myc-FLAG cDNA ORF (CAT#: RC223204) Clones were purchased from OriGene. Site-directed mutagenesis was performed using QuikChange II XL site-directed mutagenesis kit (Agilent Technologies ...
-
bioRxiv - Immunology 2024Quote: For Western blotting and ELISA assays, human glutaredoxin 3 (GLRX3, catalog # TP302731) and human Tropomodulin1 (TMOD1, catalog # TP301134) were obtained from OriGene Technologies Inc ...
-
bioRxiv - Cell Biology 2024Quote: ... The Ubiquitin-like binding domain (Ubl) of Parkin was obtained by PCR amplification of amino acids 1–108 from the pCMV-Parkin plasmid (Origene). The PCR product was further cloned into pGEX-4T-1 (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: The Arc silencing 29mer shRNA sequence: CTCACGCCTGCTCTTACCAGCGAGTCAGT in retroviral GFP containing vector (Gene ID = 54323) obtained from OriGene (TG7-10356). was delivered to cultured neurons at DIV4 using Lipofectamine3000 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: Untagged HELLS in the pCMV6-XL4 vector (SC126963) and Myc-DDK HELLS in the pCMV6-Entry vector (RC212231) were purchased from Origene. A custom mutation of the Myc-DDK HELLS construct that encodes HELLS K254R was created by Origene ...
-
bioRxiv - Cell Biology 2024Quote: A plasmid encoding wild-type human COL2A1 (variant IIB, consensus sequence) fused to GFP was obtained from Origene (#RG221644; NM_033150). The C-terminal GFP tag was removed and replaced by a stop codon ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... CGGBP1 knockdown was done using CGGBP1-shRNA (targeting four different regions in ORF) using lentiviral transduction by overexpression of CGGBP1-lentivirus constructs acquired from Origene. The lenti-packaging plasmids ...
-
bioRxiv - Biochemistry 2020Quote: The cDNA encoding full-length human SNED1 (fl-SNED1) cloned into pCMV-XL5 (clone SC315884) was obtained from Origene (Rockville, MD). The cDNA encoding full-length murine Sned1 cloned into pCRL-XL-TOPO (clone 40131189 ...
-
bioRxiv - Cancer Biology 2020Quote: The expression vector pCMV6-Entry-ETV7 C-terminally tagged with DDK-Myc tags was purchased from Origene (Tema Ricerca, Bologna, Italy). The lentiviral vector pAIP-ETV7 was obtained by cloning using the following primers to amplify the ETV7 gene from pCMV6-Entry-ETV7 and inserting it into the pAIP-Empty plasmid (the tails containing restriction endonucleases’ target sequences are indicated in lowercase):
-
bioRxiv - Immunology 2021Quote: ... The Emory University Integrated Genomics core facility (Atlanta, GA) subcloned mouse and human Esm-1 cDNA from pCMV6 (Origene, Rockville, MD) into pT3 ...
-
bioRxiv - Neuroscience 2020Quote: pLenti-C-Myc-DDK (control) and human PLCγ2-myc-DDK (WT) in pLenti-C backbone vectors were obtained from OriGene (PS100064, RC200442L1). PLCγ2-myc-DDK was subjected to site-directed mutagenesis (QuikChange Lightning Multi Site-Directed Mutagenesis Kit ...
-
bioRxiv - Pathology 2021Quote: ... Additional positive and negative control experiments were performed in which purified recombinant PBX1 and MEIS2 proteins (purchased from Origene, Rockville, MD) were incubated with the same concentrations of each drug and assayed.
-
bioRxiv - Physiology 2021Quote: ... GGC CCG ATT GCT TCG AGA A (Nrf1) and pRFP-C-RS scrambled shRNA plasmid vectors were obtained from OriGene (TR30015). For analgesia ...
-
bioRxiv - Cell Biology 2022Quote: ... we subcloned their ORFs into pCMV6 vector with HA or DDK tag directly from a commercially purchased pCMV6-GFP and pCMV6-HA expression clones (Origene Technologies), respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... to create primer sets (Table S1) for cloning and/or subcloning of open-reading frame (ORF) of TMEM163 (purchased from Origene Technologies), SLC30A1/ZNT1 purchased from Origene Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+ and HEK293/GC-B+ cell lines were generated from HEK293 parental cell transfected with plasmids (OriGene, Rockville, MD) containing either human GC-A or GC-B cDNA sequences ...
-
bioRxiv - Physiology 2023Quote: ... containing the CMV promoter in front of the human FHF2-VY cDNA (NCBI Reference Sequence NM_001139500, full-length cDNA clone purchased from Origene, Rockville, MD) silently mutated in the sequence targeted by the FHF2 shRNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid pCMV6-AC-GFP-rtTA-APE1 (for WT tGFP-APE1 protein) was prepared by PCR full-length APE1 from pET28HIS-hAPE1 and subcloned into pCMV6-AC-GFP-rtTA vector (Origene #PS100125) at AscI and RsrII sites ...
-
Increased dosage of wild-type KRAS protein drives KRAS-mutant lung tumorigenesis and drug resistancebioRxiv - Cancer Biology 2024Quote: The CRISPR-based AAVS1 system for targeted gene insertion into the AAVS1 locus was purchased from Origene (SKU GE100023, SKU GE100024). We cloned the dsRed-IRES-GFP-KRAS-WT-PGK-Hygro and dsRed-IRES-GFP-KRAS-G12V-PGK-Hygro cassettes into the pAAVS1 vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... gRNAs were obtained from Integrated DNA technology as two single strand oligos and annealed in 40 μl of annealing buffer (Origene, #GE100007) with 2 μl of each oligo (100 μM ...
-
bioRxiv - Neuroscience 2023Quote: ... This residue is alanine in the NCBI RefSeq sequence but is a threonine in commercial clones available from Origene (catalog # RG220167), as well as a conserved threonine across most other mammalian species (Fig ...
-
bioRxiv - Bioengineering 2024Quote: ... Primers used in this study were purchased from Predesigned qPCR Assays (Integrated DNA Technologies) or qPCR Primer Pairs (OriGene Technologies, Inc.).
-
bioRxiv - Cancer Biology 2024Quote: The overexpression of TSPO in the U87MG cell line (U87MG+TSPO) was performed using the TSPO encoding plasmid from (Origene RG220107) which contains the C-terminal MYC/DDK tag ...
-
bioRxiv - Cancer Biology 2021Quote: Cxcl5 (NM_009141) Mouse Tagged ORF Clone Lentiviral Particles containing 107 transduction units/ml were purchased from Origene (Cat no: MR200761L4V; Rockville, MD). 50 μl of lentiviral suspension was added to sub-confluent KRC line in a single well of a 24-well plate containing 200 μl of complete media ...
-
bioRxiv - Neuroscience 2020Quote: CaMKIIα and calmodulin expression in Drosophila cells was accomplished as follows: CaMKIIα and calmodulin coding sequences were copied from human cDNA clones CAMK2A transcript variant 2 (catalog SC109000, Origene, Rockville MD) and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829 ...
-
bioRxiv - Cancer Biology 2021Quote: ... siRNA oligo duplex of Locus ID 2932 (SR301979) and scrambled negative control siRNA Duplex siRNA (SR30004) were purchased from Origene (Rockville, MD).
-
bioRxiv - Biochemistry 2020Quote: Viral vectors expressing lentiviral particles with 4 unique 29mer target-specific shRNA (A/B/C/D) to murine PRDX4 and 1 scramble control (non-specific or NS) were purchased from Origene (Rockville, MD). MIN6 cells were seeded on 48 well plates and cultured overnight in 0.3 mL medium ...
-
bioRxiv - Microbiology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA); the goat anti-mouse MSR1 (Cat# AF1797) ...
-
bioRxiv - Immunology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA). The mouse anti-human MSR1 (Cat# MAB2708 ...
-
bioRxiv - Neuroscience 2021Quote: ... constructs in the pGFP-V-RS vector and a non-targeting (NT: gcactaccagagctaactcagatagtact) pGFP-V-RS plasmid were purchased from OriGene (Cat. # TL515175). For lentivirus-mediated expression ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+/AT1+ and HEK293/GC-A+/AT2+ cell lines were generated from HEK293/GC-A+ transfected with lentiviral particle with clones of either human AT1 or AT2 receptor (OriGene, Rockville, MD) using polybrene transfection agent ...
-
bioRxiv - Neuroscience 2022Quote: Plasmid constructs overexpressing Myc-ddk tagged wild-type human α-syn (Myc-α-synuclein) and Myc-ddk tagged wild-type human UBA52 (Myc-UBA52) were purchased from Origene technologies ...