Labshake search
Citations for Origene Technologies :
251 - 300 of 464 citations for Parvalbumin PVALB cDNA ORF Clone Mouse N His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... DDK-MYC tagged RBFOX2 cDNAs were purchased from Origene in pCMV6-Entry vector (Cat ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cDNA of Zbtb10 was amplified from Origene (MR214195L4) Zbtb10 mouse tagged ORF clone using Zbtb10-fwd (5’ ATGTCGTTCAGTGAGATGAACCG ...
-
bioRxiv - Neuroscience 2023Quote: ... Human Adgrd1 cDNA was obtained from Origene (Cat: PS100001). Generation of Adgrd1 N-terminal mutations was carried out using Q5 site directed mutagenesis kit (NE Biolabs ...
-
bioRxiv - Biophysics 2023Quote: ... the cDNA encoding for human TMEM115 (Origene cat# RG203956) was cloned into pEGFP-C1 using NheI and BsrGI restriction sites ...
-
bioRxiv - Cell Biology 2024Quote: ... Human Unk was first amplified from cDNA (Origene SC315847) using Fwd ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1-2272) were expressed with a C-terminal Myc-DDK (FLAG) tag from a pCMV6-Entry backbone (#RC218208, Origene, USA) in Expi 293F suspension cells (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse PRRX1 (Origene TA803116), rabbit YAP (Cell Signaling 14074) ...
-
bioRxiv - Cancer Biology 2020Quote: The expression vector pCMV6-Entry-ETV7 C-terminally tagged with DDK-Myc tags was purchased from Origene (Tema Ricerca, Bologna, Italy). The lentiviral vector pAIP-ETV7 was obtained by cloning using the following primers to amplify the ETV7 gene from pCMV6-Entry-ETV7 and inserting it into the pAIP-Empty plasmid (the tails containing restriction endonucleases’ target sequences are indicated in lowercase):
-
bioRxiv - Physiology 2021Quote: ... the pRL-TK renilla luciferase vector as an internal control and varying concentration of a CASR containing a myc tag vector (Origene Inc.). After 24 hr incubation with standard medium containing 1.5 mM calcium the cells were assayed for Cldn14 reporter expression using a luciferase assay system from Pormega Corp ...
-
bioRxiv - Cell Biology 2022Quote: ... For protein-protein interaction experiments using the pCMV6 vector with HA or Myc-DDK peptide tag at the 3’-end (Origene Technologies), we used the same IF cloning system to subclone cDNAs of our genes-of-interests (GOIs ...
-
bioRxiv - Immunology 2022Quote: ... Plasmid containing human IL-12p35 cDNAs were obtained from Origene. One day before transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA of human FIP200 was purchased from OriGene (SC114884), pmCherry_Gal3 was a gift from Hemmo Meyer (Addgene plasmid #85662 ...
-
bioRxiv - Immunology 2020Quote: ... The murine UNG2 (mUNG2) was amplified from mUNG2 cDNA (OriGene), and cloned into FLAG-HA-pcDNA3.1 vector (Addgene ...
-
bioRxiv - Genetics 2022Quote: ... WT ALDH9A1 cDNA plasmid was purchased from OriGene (cat#: 216921). A nonsynonymous missense variant (c.26c>G ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNAs were first subcloned into pLenti (Origene Cat. no. PS100092) maintaining the DDK-MYC tag and then into Pentr4FLAG (Addgene Cat ...
-
bioRxiv - Genomics 2023Quote: c-myc-tagged Ephb4 cDNA in pCMV6 was from Origene. Single K650N ...
-
bioRxiv - Cancer Biology 2023Quote: ... Crohn’s and ulcerative colitis cDNA arrays were purchased from Origene Technologies (catalog #CCRT102 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and creatine kinase U-type (CKMT1) cDNA (Origene, Rockville, MD) were cloned into pET-30a vectors (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: Colon cancer cDNA Array was purchased from Origene (Cat#: HCRT104). For normal colon tissue used in the CRC cell array ...
-
bioRxiv - Plant Biology 2024Quote: ... The separated proteins were then subjected to immunoblotting using GST antibody (M20007L; Abmart; 1:5,000 dilution) and His antibody (F013; ORIGENE; 1:5,000 dilution) or MBP antibody (AE016 ...
-
bioRxiv - Cell Biology 2021Quote: ... the antibodies used were rabbit monoclonal anti-GLI1 (Clone EPR4523, Origene Technologies) at a 1:1000 dilution and anti-Lamin A/C (Cell Signaling Technologies 2032 ...
-
bioRxiv - Immunology 2024Quote: ... Individual clones were screened by western blotting with anti-ZFAND6 (Origene; TA335508).
-
bioRxiv - Neuroscience 2023Quote: We used a pCMV-human TFEB expressing vector from Origene (clone # sc122773), used previously 27 ...
-
bioRxiv - Immunology 2024Quote: ... anti-DDK (FLAG) (clone OTI4C5, #TA50011, 1:1000; OriGene Technologies; RRID: AB_2622345), anti-LC3B (#ab51520 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human siRNA Oligo Duplex for N-Cadherin (SR300716) and α-Catenin (SR301060) were purchased from Origene. siRNA was transiently transfected to the cells through Lipofectamine RNAimax (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... The OGT lentiviral vector was produced by first cloning OGT with C-terminal FLAG and HA tags into the pCMV6 entry vector (Origene, Rockville, MD) using the NEBuilder HiFi DNA assembly and Q5 site-directed mutagenesis kits according to the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse EDA-A2 (MC208415) and mouse OSM (MR226014) expression plasmids were purchased from Origene. Mouse NIK expression plasmid was purchased from Invivogen (pUNO1-mMap3k14) ...
-
bioRxiv - Microbiology 2020Quote: The cDNA molecules of ADAP2 and LY6E were purchased from OriGene (Cat ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was cloned out of pCMV6-AC HNRNPK (OriGene, Rockville, MD) using the primers described previously(6 ...
-
bioRxiv - Bioengineering 2022Quote: Human GDNF cDNA (NM_199234) was provided by OriGene (Rockville, MD, USA) that was propagated in DH5α E.coli ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human furin cDNA (product #RC204279) was obtained from OriGene (Rockville, MD) and inserted into the pcDNA5/FRT plasmid for stable transfection into HEK293 FRT cells ...
-
bioRxiv - Cell Biology 2023Quote: ... using a cDNA containing human MSI2 obtained from OriGene (Rockville, MD) as a template ...
-
bioRxiv - Cancer Biology 2023Quote: ... reverse transcription was performed with First-strand cDNA Synthesis kit (OriGene). For RNA-seq ...
-
bioRxiv - Biochemistry 2024Quote: ... All iRhom2 expression constructs were PCR-amplified from a cDNA (Origene) and sequentially subcloned into the p-mVenusC1 vector (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... following the manufacturer’s instructions using the cDNA encoding SNED1 from Origene as a template ...
-
A novel neural stem cell-derived immunocompetent mouse model of glioblastoma for preclinical studiesbioRxiv - Cancer Biology 2020Quote: ... mouse anti Bcat1 (TA504360, OriGene), mouse anti-GFAP (644701 ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Turbo GFP (mouse; Origene).
-
bioRxiv - Microbiology 2022Quote: ... and mouse Cd164 (Origene, #MR201951) cDNAs were cloned into EcoRV-cut plenti-CMV-Puro-DEST (Addgene #17452 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-MIC19 (TA803454, Origene) at 1:1,000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... LGALS9 (OTI19H8, Mouse monoclonal, Origene) at 1:200 ...
-
bioRxiv - Molecular Biology 2022Quote: ... mouse anti-TurboGFP (TA150041, Origene), mouse anti-FLAG M2 (F1804 ...
-
bioRxiv - Cancer Biology 2024Quote: ... mouse anti-CDK2 (Origene TA502935), rabbit anti-Cdc2 (Cell Signaling 28439) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and stained with 1:2000 HRP-conjugated anti-human ACE2 (clone OTI1D2, Origene) or 1:5000 HRP-conjugated donkey anti-human IgG (Jackson Immuno Research ...
-
bioRxiv - Immunology 2022Quote: ... HEK293 cells were transduced using the LentiORF® clone of CIITA (OriGene RC222253L3). The cells were selected using puromycin selection marker for 2 passages over the period of 7 days ...
-
bioRxiv - Immunology 2024Quote: mRNA was synthesized encompassing the open reading frame of a fusion protein coding for the full-length ANKRD55 isoform 201 coupled to C-terminal MYC-FLAG tags as provided by a commercial vector (Origene, Cat. No. RC221211). Unmodified synthesized ANKRD55 mRNA transcript was capped at the 5’ end using wild-type bases CleanCap® AG (TriLink BioTechnologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... Human cDNA encoding FBOX genes were procured from Origene (Rockville, MA, USA). mVenusC1 was gifted by Dr ...
-
bioRxiv - Microbiology 2020Quote: ... the ACE2 coding sequence was amplified from an ACE2 cDNA (Origene Inc) using primers with flanking 5’-XbaI and 3’-SalI sites and cloned into pLenti.CMV.GFP.puro ...
-
bioRxiv - Cancer Biology 2021Quote: ... T192-RFP-3xHA - was generated by subcloning the cDNA of TMEM192 (Origene) together with monomeric Red Fluorescent Protein (mRFP ...
-
bioRxiv - Cell Biology 2021Quote: ... prosaposin was amplified from human prosaposin cDNA (pCMV6-XL5-PSAP, Origene, # SC118405), SBP-mCherry and the Str-KDEL_SBP-mCherry-GPI (Addgene # 65295 ...
-
bioRxiv - Biophysics 2022Quote: Human LRRC8A and LRRC8C cDNAs cloned into pCMV6 were purchased from OriGene Technologies ...