Labshake search
Citations for Origene Technologies :
51 - 100 of 464 citations for Parvalbumin PVALB cDNA ORF Clone Mouse N His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... using the c17orf80 sequence (NM_001100621) amplified from a commercially available tagged ORF clone (OriGene; RC221916L3) and pDEST-pcDNA5-BirA-FLAG vectors (Couzens et al. ...
-
bioRxiv - Molecular Biology 2021Quote: Alkbh1 Rat Tagged ORF Clone Lentiviral Particles and Mock control were purchased from Origene (Cat# RR214755L2V). Cells were transfected with lentiviral particles in the presence of polybrene (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... shSlit2 CT-2A cells were infected with SLIT2 (NM_004787) Human Tagged ORF Clone Lentiviral Particle (Origene) in accordance with manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... the KPNB1 coding sequence was PCR amplified from the KPNB1 ORF clone plasmid (Origene, cat# RC200659) and XbaI and BamHI restriction sites were added to the ends of the fragment ...
-
bioRxiv - Biophysics 2023Quote: ... or N1β with an N-terminal tGFP tag (custom plasmid from Origene) by Lipofectamine 3000 ...
-
bioRxiv - Neuroscience 2023Quote: The human GPR37L1 cDNA clone (Origene) was subcloned into pcDNA3.1+ (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... and Bach2 ORF (Origene, MR224703 cloned into Addgene ...
-
Targeted rescue of synaptic plasticity improves cognitive decline after severe systemic inflammationbioRxiv - Neuroscience 2021Quote: ... the Arc cDNA open reading frame (ORF) was cut from a pCMV6-Entry_Arc vector (Origene, MR206218) by restriction digest using EcoRI and XhoI (Fermentas ...
-
bioRxiv - Cell Biology 2024Quote: The following primary antibodies (Ab) were used: anti-afadin mouse monoclonal Ab (mAb) (#AM26175PU-N, clone 3, OriGene; 1:50 dilution for immunofluorescence ...
-
bioRxiv - Cancer Biology 2021Quote: ... THEM6 human tagged ORF clone overexpressing plasmid and respective control (RC201709 and PS100001, Origene, Rockville, MD, USA) were purchased from Origene ...
-
bioRxiv - Cancer Biology 2020Quote: ... LNCaP cells were transfected with SLFN5 (NM_144975) Human MYC-Tagged ORF Clone (RC216330, Origene, Rockville, MD, USA) or the corresponding empty vector plasmid (PS100001 ...
-
bioRxiv - Cancer Biology 2020Quote: Site-directed mutagenesis was performed using 50ng of KAT3A / CBP (CREBBP) (NM_004380) Human Tagged ORF Clone (OriGene) as the dsDNA template ...
-
bioRxiv - Biochemistry 2023Quote: Myc-DDK-tagged lenti ORF clone of c1orf112 (Lenti-Myc-FLAG-RADIF) was obtained from Origene (RC211444L1). Human FIGNL1 sequence-verified cDNA (FIGNL1-cDNA ...
-
bioRxiv - Biophysics 2023Quote: A Myc/DDK eptiope-tagged Pin1 (NM_006221) Human Tagged ORF Clone (Cat# RC202543) was obtained from OriGene Technologies Inc ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-DDK-Flag tag (Origene, 1:2000); rabbit anti-pS/TQ (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-CC10 (Origene, AM26360PU-N), Mouse-anti-CD63 (DSHB Hybridoma Product H5C6 ...
-
bioRxiv - Cancer Biology 2023Quote: ... were transformed by heat shock in 42°C water bath using SETD2 Human Tagged ORF Clone (Origene, RG224760) or pCMV6□AC□GFP Mammalian Expression Vector (Origene ...
-
bioRxiv - Cancer Biology 2024Quote: ... to generate Jurkat BTLA/NFAT-eGFP cells or CD160 (NM_007053) Human Tagged ORF Clone Lentiviral Particles (Origene, #RC204886L3V), to generate Jurkat CD160/NFAT-eGFP cells respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... Jurkat NFAT eGFP cells were transduced with CD272 (BTLA) (NM_181780) Human Tagged ORF Clone Lentiviral Particles (Origene, #RC219458L3V) to generate Jurkat BTLA/NFAT-eGFP cells or CD160 (NM_007053 ...
-
bioRxiv - Cell Biology 2021Quote: Mouse Igfbp3 cDNA (Origene) was amplified with attB-containing primers and cloned into pDONR 221 (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse anti-Myc-tag (9E10) was purchased from Origene; Rabbit anti-GM130 was purchased from Abcam ...
-
bioRxiv - Cancer Biology 2020Quote: ... 22Rv1 SLFN5 KO cells were further transfected with SLC7A5 (NM_003486) Human Tagged ORF Clone (RC207604, Origene, Rockville, MD, USA). Cells were then clonally selected ...
-
bioRxiv - Biochemistry 2022Quote: ... HEK293-Klotho cells were seeded at density of 500 000 cells/well on 6-well tissue culture plates and transfected with RhoGDI1 (ARHGDIA) (NM_004309) Human Tagged ORF Clone (RG200902 OriGene) using Lipofectamine 3000 Transfection Reagent (L3000015 Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2018) E-cadherin deficient PDAC021T were transfected with human E-Cadherin mGFP-tagged Tagged ORF Clone Lentiviral Particle (Origene) at 25 multiplicity of infection (MOI) ...
-
bioRxiv - Neuroscience 2023Quote: Expression vectors of Myc-DDK-tagged human ORF clones of ANKS1B and SYNGAP1 were purchased from Origene (#RC211877, #RC229432). V5-epitope or GFP-tagged mutants were cloned into the same expression backbone ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of expression clone cDNA (Origene NM_001923) or control cDNA (Origene PS100093 ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... the following cDNA clones were purchased from Origene: pCMV6-Chpt1 (RefSeq NM_144807) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The ORF encoding Fgfr2iiib (Origene; MC221076), the IRES sequence from pLVX-IRES-Puro (Clontech ...
-
bioRxiv - Cell Biology 2021Quote: ... or human GPR87 ORF (Origene, RC218486L3)) for 6 hrs ...
-
bioRxiv - Neuroscience 2022Quote: Plasmids: HA-tags were attached to mouse VASH1 (Origene, MR222520) and VASH2 (Origene ...
-
bioRxiv - Cancer Biology 2022Quote: ... LSAMP stable transformants were established by transfecting COR-L279 cells with a tagged ORF clone of this gene (Origene; # RC207618) followed by 1mg/ml G418 selection (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... hnRNPUL1 (NM_007040) and PEG10 (NM_015068.3) were PCR amplified from ORF clones (hnRNPL, GenScript #OHu14072; hnRNPUL1, Origene #RC200576; PEG10, GenScript #OHu101111) and the products were cloned into the mammalian expression plasmid pCAGGS ...
-
bioRxiv - Molecular Biology 2024Quote: NSC34 and HEK293T cells were transfected with a plasmid coding for the hnRNPA2B1 (NM_002137) Human Tagged ORF Clone (Origene, RC219318) using Lipofectamine™ 3000 Transfection Reagent (Invitrogen L3000001) ...
-
bioRxiv - Cancer Biology 2024Quote: USP39 (NM 006590) human mGFP-tagged ORF clone lentiviral particles (RC209551L4V) and control lentiviral particles (PS100093V) were purchased from OriGene.
-
bioRxiv - Neuroscience 2021Quote: ... SP6 transcribed antisense and T7 transcribed sense control probes were synthesized from mouse Fcgr1 (NM_010186) cDNA clone (MR225268, OriGene) using 1 set of primers (forward ...
-
bioRxiv - Immunology 2022Quote: ... using NKG2D and Ly49A cDNA clone expression vectors (Origene). NKG2D-S/L were generated by PCR using forward 5’ TAGTAGTCTCGAGCCACCATGAGCAAATGCCATAATTACGACCTC 3’ (short isoform ...
-
bioRxiv - Genetics 2022Quote: ... For WDR34p.Arg183Trp and WDR34p.Gly394Ser mutants cells were transfected with WDR34 human Myc-DDK-tagged tagged ORF Clone (RC204288, OriGene, Rockville, Maryland, USA) and for WDR60p.Ala911Val mutant cells were transfected with WDR60 Mouse Myc-DDK-tagged tagged ORF Clone (MR217536 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3×104 HT29 cells and 3×105 Caco2 cells were seeded in 6-wells plates and transduced with the Human Tagged ORF Clone lentiviral particles containing the pLenti-C-mGFP-P2A-Puro vector fused to the CaSR gene (RC211229L4V, OriGene, USA) (HT29CaSR-GFP and Caco2CaSR-GFP) ...
-
bioRxiv - Plant Biology 2023Quote: ... overnight at 4°C (anti-PsbA; AS05 084A; anti-PsaB; AS10 695; anti-APC; AS08 277; Agrisera, anti-His tag; TA150087; OriGene). The membrane was washed 3 times in TBST-T at room temperature for 15 minutes each wash followed by incubation with secondary polyclonal anti-rabbit antisera HRP for one hour at room temperature in TBS-T (Jackson ImmunoResearch ...
-
bioRxiv - Neuroscience 2024Quote: ... The Tmem120b cDNA clone was purchased from Origene (MR205067, NM_001039723). The Opto-PLD active and inactive constructs were purchased from Addgene (140114 ...
-
bioRxiv - Immunology 2021Quote: A DNA plasmid containing full-length cDNA sequence with a Flag-Myc tag (Origene #RC221091) was verified by Sanger sequencing and used as template in T7-promoter-based in vitro transcription/translation reactions (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: ... whereas the ORF encoding human p130 from Origene.
-
bioRxiv - Cancer Biology 2020Quote: A Myc-DDK-tagged ORF clone of TCF4 and the negative control pCMV6 were used for in transient transfection (RC224345; OriGene, Rockville, Maryland, USA) using previously described methodology 37 ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA clone for Cap1 was purchased from Origene (CAT#: MR207594) and subsequently cloned into lentiviral vector pLVX-puro (Clontech ...
-
bioRxiv - Microbiology 2020Quote: ... and dipeptidyl peptidase-4 (DPP4) cDNA clones were obtained from Origene, and cloned into a pcDNA3 vector (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... Pebp1 (MR201759) and Rack1(MR204575) cDNA clones were purchased from Origene, USA ...
-
bioRxiv - Cell Biology 2023Quote: ... or control or GCN5L1 ORF lentiviral particles (Origene, USA), followed by puromycin selection ...
-
bioRxiv - Physiology 2024Quote: ... and Control and GCN5L1 ORF lentiviral particles (Origene, USA), followed by puromycin selection ...
-
bioRxiv - Neuroscience 2023Quote: Mouse HAPLN1 cDNA was purchased (Origene, Rockville, MD) and cloned as a fusion to Venus into the pCAGGS mammalian expression plasmid ...
-
bioRxiv - Biochemistry 2020Quote: The human cDNA clones of LRPPRC and SLIRP were provided by OriGene (product numbers ...