Labshake search
Citations for Origene Technologies :
151 - 200 of 464 citations for Parvalbumin PVALB cDNA ORF Clone Mouse N His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... we obtained the WT mS29 gene as a Myc/DDK-tagged ORF from Origene (Cat# RC223182). Using restriction sites AsiSI and PmeI ...
-
bioRxiv - Molecular Biology 2024Quote: ... Control and CGGBP1-targeting-shRNA (against 4 regions in the CGGBP1 ORF) were procured from Origene. Third-generation lenti-packaging plasmids ...
-
bioRxiv - Cell Biology 2024Quote: The DNAJ cDNA (corresponding to residues 4316-4420 of sacsin) was subcloned using mouse pEGFP-sacsin full length cDNA (OriGene Technologies, Rockville, MD, USA) and inserted in frame with GST into the pGEX6 vector ...
-
bioRxiv - Neuroscience 2020Quote: Full-length cDNAs encoding mouse IgSF8 (BC048387) and Tenascin-R (BC138043) were purchased from Origene and Source Bioscience ...
-
bioRxiv - Neuroscience 2024Quote: ... Louis, MO) (96, the C-terminal HA-tagged ERα was constructed from the purchased ERα cDNA expression clone (Origene #MG227304) into BamHI and EcoRI sites of pcDNA3 vector using PCR amplification ...
-
bioRxiv - Cancer Biology 2020Quote: A C-terminal Myc-DKK-tagged RNF43 ORF expression construct was purchased from Origene (Origene, Cat# RC214013) and verified by Sanger sequencing ...
-
bioRxiv - Cell Biology 2022Quote: ... ATG7-/- and Scr Caco-2 cells as discussed previously.11 Occludin ORF in pCMV6-AC-GFP (Origene) and corresponding control plasmid were used to transfect Caco-2 cells using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Physiology 2023Quote: ... The SIK3-Flag plasmid was constructed by subcloning of a 3xFlag tag to replace the Myc-DDK tag in the mSIK3-Myc-DDK plasmid (MR211912, OriGene). SIK3-Flag-ΔPKA (ΔPKA ...
-
Mapping chromatin state and transcriptional response in CIC-DUX4 undifferentiated round cell sarcomabioRxiv - Cancer Biology 2023Quote: ... CIC (Origene AP50924PU-N,), ETV5 (Cell Signaling 16274) ...
-
bioRxiv - Immunology 2020Quote: ... washing with PBST three times, mouse anti-HA-tag lgG2a mAb (4A.Biotech, 4ab000002, Beijing, China 1:1000) or lgG1 mAb (Origene, TA180128, USA, 1:2000) were added into each well (40 μl/well) ...
-
bioRxiv - Biochemistry 2020Quote: The cDNA encoding full-length human SNED1 (fl-SNED1) cloned into pCMV-XL5 (clone SC315884) was obtained from Origene (Rockville, MD). The cDNA encoding full-length murine Sned1 cloned into pCRL-XL-TOPO (clone 40131189 ...
-
bioRxiv - Cancer Biology 2021Quote: A mouse Nup210 full length cDNA (NM_018815) encoding vector (pCMV6-Nup210-Myc) was purchased from Origene Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: The human KMT5C (NM_032701.4) open reading frame (ORF) was cloned from the pCMV6-Entry expression vector (Origene, RC203881) into the pLV-EF1a-IRES-Hygro lentiviral backbone (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: CaMKIIα and calmodulin expression in Drosophila cells was accomplished as follows: CaMKIIα and calmodulin coding sequences were copied from human cDNA clones CAMK2A transcript variant 2 (catalog SC109000, Origene, Rockville MD) and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829 ...
-
bioRxiv - Physiology 2021Quote: ... Full-length human (RC211179) and mouse GCGR (MR207767) both Myc-DDK-tagged cDNA were obtained from OriGene Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... human Arcn1 with Myc and Flag tags (RC210778, Origene), Flag-APP-C99 was a kind gift from Wenjie Luo (Weill Cornell Medical College) ...
-
bioRxiv - Cancer Biology 2022Quote: ... pCMV-CIC with myc-tag was purchased from Origene and validated previously.
-
bioRxiv - Microbiology 2022Quote: ... and ADK5b (Origene, AM09121PU-N). VLPs were adhered to the ELISA plate ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transduced with pLenti-C-Myc-DDK-P2A-Puro vector expressing SOX10 (NM_006941) ORF nucleotide sequence (OriGene, #RC203545L3V) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... DSG2 and DSG3-Fc proteins and N-CAD-Fc protein were detected with the following antibodies: mouse-anti-DSG2 (#BM5016, Origene, 1:200); mouse-anti-DSG3 5G11 (#32-6300 ...
-
bioRxiv - Immunology 2023Quote: Tissue paraffin sections were stained with H&E for histopathological evaluation or with biotinylated anti-mouse-IgG (Vector; BA-9200) for the detection of immune complex deposits and anti-human IL23A (OriGene; AM20386PU-N) for the detection of human IL23A protein in various tissues.
-
bioRxiv - Cancer Biology 2022Quote: ... and a human GAB1 3′-UTR reporter plasmid (containing 3770 bp immediately downstream of the end of the GAB1 ORF cloned into pMirTarget, Origene), a control Renilla luciferase plasmid (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... MG87.TRKA and MG87.TRKB cells were transfected with PTPσ (RefSeq number NM_019140) Myc-DDK-tagged open-reading frame (ORF) plasmid purchased from OriGene (#RR209636), pCMV6-Entry vector with C-terminal Myc-DDK Tag (#PS100001 ...
-
bioRxiv - Molecular Biology 2021Quote: ... CGGBP1 depletion in these cells was achieved by lentiviral transduction of the lentiviral shmiR constructs (four different sites in the ORF) targeting CGGBP1 (KD) or Control-shmiR (CT) obtained from Origene as described earlier (PMID ...
-
bioRxiv - Immunology 2022Quote: ... then infected with third generation lentiviral particles encoding the BCL6 open reading frame (pLenti-BCL6 ORF-mGFP) or GFP alone (Origene). For knockdown ...
-
bioRxiv - Cell Biology 2024Quote: ... pLenti-C-Myc-DDK (RC210158L1; carrying the ORF of human CX36; GJD2; NM_020660) was obtained from Origene (Rockville, Md, USA).
-
bioRxiv - Evolutionary Biology 2024Quote: ... CGGBP1 knockdown was done using CGGBP1-shRNA (targeting four different regions in ORF) using lentiviral transduction by overexpression of CGGBP1-lentivirus constructs acquired from Origene. The lenti-packaging plasmids ...
-
bioRxiv - Biochemistry 2021Quote: ... rabbit anti-Adam10 (Origene, AP05830PU-N), mouse anti-Alix (Santa Cruz ...
-
bioRxiv - Immunology 2022Quote: ... or anti-NEU4 (AP52856PU-N, Origene) antibodies as previously described.28 ...
-
bioRxiv - Cell Biology 2023Quote: ... PRB-114P) was from Covance. Mouse monoclonal anti-human JC (clone 3C7, aka OTI3C7) (cat. TA504168) was obtained from OriGene Technologies ...
-
bioRxiv - Biochemistry 2020Quote: ... the mGFP cDNA was inserted between the region encoding the 71st and 82nd amino acids of mouse Gαs (Origene) in the pcDNA3.1 (+ ...
-
bioRxiv - Cancer Biology 2024Quote: ... The HrasG12V/Rbm10flox mouse metastatic 64860M cells were used to generate Rbm10-expressing cells by transducing pLVX-puro vector cloned with mouse Rbm10 cDNA (NM_145627, Origene) (64860M-Rbm10) ...
-
bioRxiv - Cell Biology 2022Quote: ... to create primer sets (Table S1) for cloning and/or subcloning of open-reading frame (ORF) of TMEM163 (purchased from Origene Technologies), SLC30A1/ZNT1 purchased from Origene Technologies) ...
-
bioRxiv - Plant Biology 2024Quote: ... using 6xhistidine Epitope Tag antibodies (Acris, OriGene Technologies, USA, Fig. S3).
-
bioRxiv - Genetics 2024Quote: ... synaptopodin (AP33487SU-N, 1:200; Origene, MD), cortactin (MA5-15831 ...
-
bioRxiv - Immunology 2023Quote: ... and either with a lentiviral expression vector carrying GFP-tagged MCEMP1 ORF or insertless (mock) vector for MCEMP1 overexpression (lentivirus were purchased from Origene, MD, USA). A MOI of 50 was necessary to achieve a satisfactory infection rate ...
-
bioRxiv - Microbiology 2021Quote: ... Human cDNA (Origene) of NgR1 (NM_023004) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized using the first-strand cDNA synthesis kit (Origene) with 1 μg of total RNA ...
-
bioRxiv - Cell Biology 2024Quote: ... and TMEM255A followed by the Myc-FLAG tag were purchased from Origene (#RC203657 ...
-
bioRxiv - Immunology 2021Quote: ... The Emory University Integrated Genomics core facility (Atlanta, GA) subcloned mouse and human Esm-1 cDNA from pCMV6 (Origene, Rockville, MD) into pT3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... for testing were co-transfected with Renilla control plasmid (20 ng) and either a plasmid containing mouse Tbx1 cDNA (200 ng, Origene, PS100001) or empty vector control (200ng ...
-
bioRxiv - Neuroscience 2022Quote: ... clone 4D6 (Origene, 1:1000), anti-beta-Amyloid ...
-
bioRxiv - Developmental Biology 2024Quote: ... POSTN (Origene TA804575S clone OTI2B2), or MYH6 (Sigma-Aldrich AMAb90950 clone CL2162) ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-RFP (1:1000, OriGene, AP09229PU-N), guinea pig anti-pSmad1/5/8 (1:300 ...
-
bioRxiv - Neuroscience 2023Quote: ... CRHR2 antibody (1:1000, ORIGENE, rabbit, AP17244PU-N), Grin2B antibody (1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... The cDNA coding for FcγRI was amplified from the NM_000566 cDNA (Origene) with the following primers ...
-
bioRxiv - Neuroscience 2021Quote: ... elegans cDNA library (OriGene) using 5’ AGAGAGAATGATGTTAGGAGG 3’ and 5’ AGTTGAAAATGAAAGAATAATGG 3’ (55°C annealing temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... Ncaph2 cDNA (Origene, MC200537) and the eGFP ORF in the pUC19 vector.
-
bioRxiv - Neuroscience 2023Quote: ... cDNAs (Origene #RC209565, #RC215868) were cloned into an AAV-expression vector downstream of the hSyn promotor ...
-
bioRxiv - Pathology 2024Quote: ... we obtained 5 μm sections from aortic valve biopsies of AVS patients (n = 5) and healthy controls (n = 2) (OriGene; Rockville, MD). Double immunofluorescence staining was performed to identify α-SMA-positive (α-SMA+ ...