Labshake search
Citations for Origene Technologies :
1 - 50 of 612 citations for Carboxypeptidase Y from Baker's Yeast since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: The Y2H assay was conducted using the DupLEX-A yeast two-hybrid system (OriGene). The EGY48 yeast strain was transformed with pJG4-5 carrying RK kinase domains or BKNs (prey ...
-
bioRxiv - Cell Biology 2022Quote: ... Validation of the Y2H result was performed by the DupLEX-ATM yeast two-hybrid system (OriGene). Human Piezo2 CTD was cloned into the pEG202NLS vector and fused with LexA ...
-
bioRxiv - Neuroscience 2022Quote: ... the lacZ-reporter gene assay of the DupLex-A yeast-two-hybrid system (Origene, Rockville, MD) was used ...
-
bioRxiv - Biochemistry 2021Quote: ... obtained from Origene Technologies (Montgomery County ...
-
bioRxiv - Microbiology 2020Quote: ... ATP6V0C” from OriGene Technologies Inc. ...
-
bioRxiv - Molecular Biology 2020Quote: ... purchased from OriGene. During the paper the SH-SY5Y are respectively named ...
-
bioRxiv - Cancer Biology 2024Quote: ... Recombinant human NAT10 derived from 293T cells was purchased from Origene Technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... was purchased from OriGene Technologies Inc (Cat ...
-
bioRxiv - Cancer Biology 2021Quote: ... were purchased from Origene. Protein and RNA extractions were performed 48 hours after transfection.
-
bioRxiv - Cell Biology 2020Quote: ... (NM_001128159) purchased from Origene or mVps54-13myc (24 ...
-
bioRxiv - Cancer Biology 2021Quote: ... TNFAIP8L1 (#RC203912) from Origene. cDNA was amplified using T7 forward primers ...
-
bioRxiv - Synthetic Biology 2023Quote: ... or purchased from Origene, Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR-amplified from OriGene Technologies plasmid MR208601 ...
-
bioRxiv - Bioengineering 2020Quote: ... the homologous arms were obtained from the pAAVS1-puroDNR plasmid from Origene (Maryland, USA). The Oatp1a1 gene was added through PCR amplification from a previously made vector we constructed using PGK_Straw_E2A_Oatp1a1 (a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... Turbofectin (#TF81001) was from Origene. Dual-Luciferase Reporter Assay (#E1910 ...
-
bioRxiv - Cell Biology 2020Quote: ... was purchased from Origene (MR207322). Primers used to generate site-directed mutagenesis or other clones are listed in supplements.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Primers were purchased from Origene Technologies (Rockville ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR primers were from Origene (MyoVa Fw - CTCACACGAACTCCTGCAAA ...
-
bioRxiv - Neuroscience 2021Quote: ... tGFP (Cat. # TA150041) from Origene; α-tubulin (Cat ...
-
bioRxiv - Cell Biology 2022Quote: ... SLC30A1/ZNT1 purchased from Origene Technologies) ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers were acquired from OriGene and the following sequences for NOX2 (Mus musculus Cybb ...
-
bioRxiv - Neuroscience 2022Quote: ... which was obtained from Origene (mouse untagged clone ...
-
bioRxiv - Physiology 2023Quote: ... anti-Mitodendra2 (TA150090) from OriGene; anti-GAPDH (GTX627408 ...
-
bioRxiv - Physiology 2023Quote: ... or by purchasing from Origene or Sino Biological ...
-
bioRxiv - Biochemistry 2023Quote: ... RBM3-GFP plasmid from Origene was used (Origene MG201130).
-
bioRxiv - Cell Biology 2023Quote: siRNAs were ordered from Origene. 300,000 v2L cells were plated in 6 well plates and allowed to settle overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... or by purchasing from Origene or Sino Biological ...
-
bioRxiv - Cancer Biology 2024Quote: ... pCMVmiR was purchased from OriGene, USA ...
-
bioRxiv - Molecular Biology 2024Quote: Recombinant CYP2A6 (TP322995) from Origene was used to test the in vitro HNEylation of CYP2A6 ...
-
bioRxiv - Cell Biology 2024Quote: Primers were obtained from OriGene Technologies Inc and commercially synthesized (Custom DNA Oligos ...
-
bioRxiv - Molecular Biology 2021Quote: The wild-type PIAS4 expressing construct was obtained from Addgene (#15208) and RNF4 from Origene (RC207273). The corresponding SAP and SIM mutants were generated as described22 ...
-
bioRxiv - Neuroscience 2020Quote: ... sh-RNA were purchased from Origene: scrambled shRNA (Origene ...
-
bioRxiv - Cancer Biology 2020Quote: ... IL11 cDNA was purchased from Origene and cloned into pBabe-puro ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was obtained from OriGene (RC209922) and a C-terminal FLAG-tag was added ...
-
bioRxiv - Cell Biology 2020Quote: PORCN-FLAG was obtained from OriGene Technologies Inc ...
-
bioRxiv - Neuroscience 2020Quote: ... GFP plasmids were obtained from Origene and Lonza ...
-
bioRxiv - Cell Biology 2020Quote: ... GAPDH antibody is from OriGene (TA802519). HSC70 antibody is from Enzo (ADI-SPA-815-F) ...
-
bioRxiv - Pathology 2021Quote: ... HMGB1 plasmid was purchased from Origene. 24h after transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... shRNA plasmids were obtained from OriGene against the following mRNA target sequences ...
-
bioRxiv - Cancer Biology 2024Quote: siRNA constructs were obtained from OriGene Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... and TRPML1 were purchased from Origene (Rockville ...
-
bioRxiv - Immunology 2023Quote: Lentiviral Particles were purchased from OriGene Technologies (catalog number TL513177V) ...
-
bioRxiv - Bioengineering 2023Quote: ... and MDR1-*3 obtained from OriGene Technologies ...
-
bioRxiv - Genetics 2023Quote: ... was purchased from OriGene (OriGene, PS100071). To construct the CHD7 lentiviral overexpression construct ...
-
bioRxiv - Genetics 2023Quote: ... was obtained from Origene (catalog # SC322276) along with an empty vector to be used as a control (catalog # PS100020) ...
-
bioRxiv - Cell Biology 2023Quote: ... TissueScanTM Tumour cDNA arrays from OriGene Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCMVMIR vector was obtained from OriGene, USA ...
-
bioRxiv - Biochemistry 2024Quote: ... was sourced from Origene (United States). GST-tagged ERK2 was acquired from Abcam (United States) ...
-
bioRxiv - Cell Biology 2024Quote: ... TissueScanTM Tumour cDNA arrays from OriGene Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... Ready-to-use primers from Origene for ApoE (HP200028) ...