Labshake search
Citations for Origene Technologies :
151 - 182 of 182 citations for Two Hybrid cDNA Library since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: Quantitative PCR (qPCR) was performed on cDNA panels of 48 healthy human tissues (OriGene Technologies, Rockville, MD) and TNBC cell lines using MX3000 (Taqman probes ROPN1 ...
-
bioRxiv - Neuroscience 2021Quote: ... hTGR5 gene was in pCMV6-Entry (GPBAR1 Human cDNA ORF Clone, NM_001077191; Origene Technologies, Inc., Rockville, MD, USA). The two plasmids were linearized with SalI (mDAT ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNAs encoding murine (pCMV-mDHCR7-Myc/DDK) and human DHCR7 (pCMV-hDHCR7-Myc/DDK) were purchased from Origene (MR223420 and RC228922 for murine and human cDNA clone respectively) ...
-
bioRxiv - Biochemistry 2019Quote: ... the coding region for full-length human GCP2 (amino acids 1-902) was amplified by PCR using its cDNA as template (NM_001256617.1, Origene). The mTagBFP (blue fluorescent protein ...
-
bioRxiv - Cell Biology 2020Quote: ... The coding sequence for the cytoplasmic domain of TLR4 was amplified from TLR4 cDNA from Origene (Rockville, MD) using the forward primer ...
-
bioRxiv - Immunology 2021Quote: pCMV6-Entry vector encoding Myc-DKK-tagged human wild type (WT) ATAD3A cDNA (NM_018188.4, Q9NV17-1) was obtained from Origene and mutations were inserted by site-directed mutagenesis using the Q5 kit (E0554S ...
-
bioRxiv - Genetics 2020Quote: Thymidine Kinase 2 Human Untagged Clone (NM_004614) containing the cDNA for transcript variant 1 was purchased from OriGene Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... sharing 91% homology with mouse JPH2 protein) and mouse Jcn cDNA (Accession number: NM_133723, Origene, Rockville, MD, USA) were inserted into pVN155 and pVC155 ...
-
bioRxiv - Biochemistry 2020Quote: ... the mGFP cDNA was inserted between the region encoding the 71st and 82nd amino acids of mouse Gαs (Origene) in the pcDNA3.1 (+ ...
-
bioRxiv - Cancer Biology 2020Quote: Control cell plugs were made by transfecting PC3 cells with C-kit Variant 1 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Neuroscience 2021Quote: ... SP6 transcribed antisense and T7 transcribed sense control probes were synthesized from mouse Fcgr1 (NM_010186) cDNA clone (MR225268, OriGene) using 1 set of primers (forward ...
-
bioRxiv - Physiology 2020Quote: ... A pCMV6-myc-DDK-Fbxl22 full-length cDNA (GenBank Accession Number: NM_175206) plasmid was purchased from Origene (Rockville, MD). The full-length Fbxl22 variant was termed Fbxl22-236 in this study ...
-
bioRxiv - Molecular Biology 2022Quote: A 1.6-kb full length human PAX9 cDNA clone (GeneBank™, accession number NM_006194.1) containing 5’ and 3’ UTRs was purchased from OriGene Technologies ...
-
bioRxiv - Neuroscience 2021Quote: pCMV-ONCM was constructed by cloning ONCM cDNA as BamHI/NotI fragment from My c-DDK-tagged oncomodulin (OriGene) in a mammalian expression vector pCMV (Addgene) ...
-
bioRxiv - Neuroscience 2021Quote: ... The different fragments were PCR amplified using custom designed primers representing the 5’ and 3’ sequence respectively with Tau cDNA (RC213312, Origene) as template ...
-
bioRxiv - Genetics 2019Quote: The human wild-type ARSA cDNA (cloned in the pCMV6 plasmid) was purchased from Origene (Cat. No. RC204319, Origene, USA). The c.925G mutations (c.925G>A ...
-
bioRxiv - Physiology 2022Quote: ... IL); cDNA coding human NACHO (TMEM35A; accession number: Q53FP2; (Gu et al., 2016)) in pCMV6-XL5 was purchased from OriGene Technologies Inc ...
-
bioRxiv - Cancer Biology 2019Quote: The TDP1 cDNA clone with expression under the control of the CMV promoter in pCMV6-XL4 was obtained from OriGene. H263A substitution was performed using the Q5 Site-Directed Mutagenesis Kit (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid containing source cDNA sequence for Mus musculus MIM (NM_144800) with C-terminal myc- and FLAG-tag was purchased from Origene (MR210506). All plasmids were sequenced to confirm the correct coding sequence (Eton Bioscience).
-
bioRxiv - Biochemistry 2023Quote: Plasmid pCMV6 encoding cDNA for human RHBDL2 and RHBDL4 with a C-terminal myc-FLAG tag was obtained from OriGene, USA ...
-
bioRxiv - Cell Biology 2023Quote: ... Golgin-45-HA-MAO was generated by >90% of the cell population was further confirmed through flow Gibson assembly using the HA-MAO vector digested with NheI/KpnI and golgin-45 cDNA (missing its C-ter, amino acids 1 to 368) purchased from Origene.
-
bioRxiv - Cancer Biology 2023Quote: ... The OC2 overexpression construct was generated by cloning the full-length OC2 cDNA (NM_004852) into the pLenti-C-Myc-DDK-IRES-Puro (Origene #PS10069) lenti-virus system ...
-
bioRxiv - Neuroscience 2024Quote: ... Louis, MO) (96, the C-terminal HA-tagged ERα was constructed from the purchased ERα cDNA expression clone (Origene #MG227304) into BamHI and EcoRI sites of pcDNA3 vector using PCR amplification ...
-
bioRxiv - Biochemistry 2020Quote: The cDNA encoding full-length human SNED1 (fl-SNED1) cloned into pCMV-XL5 (clone SC315884) was obtained from Origene (Rockville, MD). The cDNA encoding full-length murine Sned1 cloned into pCRL-XL-TOPO (clone 40131189 ...
-
bioRxiv - Immunology 2021Quote: ... The Emory University Integrated Genomics core facility (Atlanta, GA) subcloned mouse and human Esm-1 cDNA from pCMV6 (Origene, Rockville, MD) into pT3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... for testing were co-transfected with Renilla control plasmid (20 ng) and either a plasmid containing mouse Tbx1 cDNA (200 ng, Origene, PS100001) or empty vector control (200ng ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLKO.1-puro or pLKO.1 plasmids encoding target shRNA constructs (Supplemental Table 4; selected from TRC shRNA Library, Broad; purchased from Origene) were cloned as previously described ...
-
bioRxiv - Physiology 2021Quote: ... and with 300 ng of cDNA plasmid encoding wild-type or mutant human TRPA1 (pCMV6-XL4 vector, OriGene Technologies, Rockville, MD, USA). The cells were used 24–48 h after transfection ...
-
bioRxiv - Neuroscience 2020Quote: CaMKIIα and calmodulin expression in Drosophila cells was accomplished as follows: CaMKIIα and calmodulin coding sequences were copied from human cDNA clones CAMK2A transcript variant 2 (catalog SC109000, Origene, Rockville MD) and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829 ...
-
bioRxiv - Molecular Biology 2023Quote: The protein-nucleosome binding assays were carried out by incubating the purified nucleosome libraries described above and human full-length KLF4 (Origene TP306691), OCT4 (Origene TP311998) ...
-
bioRxiv - Cell Biology 2023Quote: ... expression was carried out in healthy and cancer ovarian tissues by RT-qPCR using Tissuescan™ ovarian cancer cDNA arrays I-IV (Origene Technologies, USA) and EFA6R (NM_206909.3 ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA construct was generated by PCR-amplification on the pCMV6-XL5-human full-length SORL1 cDNA plasmid (pCMV6-XL5-WT-SorLAFL OriGene Technologies, Inc, Rockville, MD, USA) using the 5’ CCGGAATTCCGGCAAAATGGCGACACGGAGCAGCAGG 3’ and 5’ TGCTCTAGAGCACTACTCGTTCTCTTCTGCCAGGGG 3’ oligonucleotides ...