Labshake search
Citations for Origene Technologies :
51 - 100 of 182 citations for Two Hybrid cDNA Library since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... using NKG2D and Ly49A cDNA clone expression vectors (Origene). NKG2D-S/L were generated by PCR using forward 5’ TAGTAGTCTCGAGCCACCATGAGCAAATGCCATAATTACGACCTC 3’ (short isoform ...
-
bioRxiv - Developmental Biology 2019Quote: mEzhip cDNA clone was obtained from ORIGENE (Ref. MG214772). hEZHIP cDNA clone was amplified from HEK-293T genomic DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... Human Cx32 and Rhodopsin cDNA was obtained from Origene and cloned into a pSVL vector (Amersham) ...
-
bioRxiv - Cancer Biology 2022Quote: ... DDK-MYC tagged RBFOX2 cDNAs were purchased from Origene in pCMV6-Entry vector (Cat ...
-
bioRxiv - Cancer Biology 2020Quote: ... C-kit Variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cDNA of Zbtb10 was amplified from Origene (MR214195L4) Zbtb10 mouse tagged ORF clone using Zbtb10-fwd (5’ ATGTCGTTCAGTGAGATGAACCG ...
-
bioRxiv - Neuroscience 2022Quote: ... the cDNA ORF Clone (OriGene Technologies, Rockville, MD, USA), or pGFP-C-shLenti-NCKAP1 Human shRNA lentiviral particles (ID 10787 ...
-
bioRxiv - Neuroscience 2023Quote: ... Human Adgrd1 cDNA was obtained from Origene (Cat: PS100001). Generation of Adgrd1 N-terminal mutations was carried out using Q5 site directed mutagenesis kit (NE Biolabs ...
-
bioRxiv - Biophysics 2023Quote: ... the cDNA encoding for human TMEM115 (Origene cat# RG203956) was cloned into pEGFP-C1 using NheI and BsrGI restriction sites ...
-
bioRxiv - Cell Biology 2024Quote: The DNAJ cDNA (corresponding to residues 4316-4420 of sacsin) was subcloned using mouse pEGFP-sacsin full length cDNA (OriGene Technologies, Rockville, MD, USA) and inserted in frame with GST into the pGEX6 vector ...
-
bioRxiv - Immunology 2022Quote: ... Plasmid containing human IL-12p35 cDNAs were obtained from Origene. One day before transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA of human FIP200 was purchased from OriGene (SC114884), pmCherry_Gal3 was a gift from Hemmo Meyer (Addgene plasmid #85662 ...
-
bioRxiv - Immunology 2020Quote: ... The murine UNG2 (mUNG2) was amplified from mUNG2 cDNA (OriGene), and cloned into FLAG-HA-pcDNA3.1 vector (Addgene ...
-
bioRxiv - Genetics 2022Quote: ... WT ALDH9A1 cDNA plasmid was purchased from OriGene (cat#: 216921). A nonsynonymous missense variant (c.26c>G ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNAs were first subcloned into pLenti (Origene Cat. no. PS100092) maintaining the DDK-MYC tag and then into Pentr4FLAG (Addgene Cat ...
-
bioRxiv - Cell Biology 2019Quote: The GFP-VPS41 constructs were cloned from hVPS41 cDNA (Origene) into a pDonor201 vector (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: Full length mouse Lox (mLox) cDNA was purchased from OriGene. The full length ORF was amplified by PCR using forward and reverse primers respectively ...
-
bioRxiv - Molecular Biology 2022Quote: ... or mouse MSS51-Myc-FLAG (mouse cDNA clone; Origene MR217897) using Lipofectamine 2000 as per manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: c-myc-tagged Ephb4 cDNA in pCMV6 was from Origene. Single K650N ...
-
bioRxiv - Cancer Biology 2023Quote: ... Crohn’s and ulcerative colitis cDNA arrays were purchased from Origene Technologies (catalog #CCRT102 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and creatine kinase U-type (CKMT1) cDNA (Origene, Rockville, MD) were cloned into pET-30a vectors (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA for the coding sequence of mouse CCN1 (Origene # MR221828) was used ...
-
bioRxiv - Neuroscience 2024Quote: ... The Tmem120b cDNA clone was purchased from Origene (MR205067, NM_001039723). The Opto-PLD active and inactive constructs were purchased from Addgene (140114 ...
-
bioRxiv - Genetics 2020Quote: Mouse expression plasmids containing cDNA encoding Rhbdf1 was obtained from OriGene. The Q5® Site-Directed Mutagenesis Kit was used to introduce site-specific mutations in the mouse Rhbdf1 plasmid according to the manufacturer’s instructions and confirmed by Sanger sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA clone for Cap1 was purchased from Origene (CAT#: MR207594) and subsequently cloned into lentiviral vector pLVX-puro (Clontech ...
-
bioRxiv - Neuroscience 2019Quote: ... The mouse Scyl1 cDNA was amplified from a construct (MR210762, Origene) and cloned into an existing vector downstream of the T3 promoter ...
-
bioRxiv - Microbiology 2020Quote: The cDNA molecules of ADAP2 and LY6E were purchased from OriGene (Cat ...
-
bioRxiv - Microbiology 2020Quote: ... and dipeptidyl peptidase-4 (DPP4) cDNA clones were obtained from Origene, and cloned into a pcDNA3 vector (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was cloned out of pCMV6-AC HNRNPK (OriGene, Rockville, MD) using the primers described previously(6 ...
-
bioRxiv - Bioengineering 2022Quote: Human GDNF cDNA (NM_199234) was provided by OriGene (Rockville, MD, USA) that was propagated in DH5α E.coli ...
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA used to generate Figure 1B were sourced from OriGene (BRCT102).
-
bioRxiv - Neuroscience 2022Quote: ... Mouse P2X5 (mP2X5) cDNA in pCMV6-Entry was purchased from OriGene and subcloned into pcDNA3.1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human furin cDNA (product #RC204279) was obtained from OriGene (Rockville, MD) and inserted into the pcDNA5/FRT plasmid for stable transfection into HEK293 FRT cells ...
-
bioRxiv - Cell Biology 2023Quote: ... using a cDNA containing human MSI2 obtained from OriGene (Rockville, MD) as a template ...
-
bioRxiv - Molecular Biology 2023Quote: ... Pebp1 (MR201759) and Rack1(MR204575) cDNA clones were purchased from Origene, USA ...
-
bioRxiv - Cancer Biology 2023Quote: ... reverse transcription was performed with First-strand cDNA Synthesis kit (OriGene). For RNA-seq ...
-
bioRxiv - Molecular Biology 2021Quote: ... two different sequences against PARP1 and TRF1: PARP1 siRNA Origene SR300098B/C, TRF1 siRNA Origene SR322000B/C, SCR siRNA Origene SR30004 and POLYPLUS INTERFERIN #409-10 as Transfection reagent).
-
bioRxiv - Molecular Biology 2021Quote: ... RNAi was performed by transfecting cells 2 days before synchronization at 20% confluence with 5 nM siRNA (scrambled sequence, two different sequences against PARP1 and TRF1: PARP1 siRNA Origene SR300098B/C ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAi was performed by transfecting cells 2 days before synchronization at 20% confluence with 5 nM siRNA (scrambled sequence, two different sequences against PARP1 and TRF1: PARP1 siRNA Origene SR300098B/C, TRF1 siRNA Origene SR322000B/C ...
-
bioRxiv - Microbiology 2022Quote: ... Two 0.5 ml aliquots of the supernatant were then mixed with 5 μg of bead-immobilized anti-basigin (Origene TA501189) and anti-neuroplastin (R&D Systems AF7818 ...
-
bioRxiv - Cancer Biology 2023Quote: ... gRNAs were obtained from Integrated DNA technology as two single strand oligos and annealed in 40 μl of annealing buffer (Origene, #GE100007) with 2 μl of each oligo (100 μM ...
-
bioRxiv - Molecular Biology 2021Quote: ... Human cDNA encoding FBOX genes were procured from Origene (Rockville, MA, USA). mVenusC1 was gifted by Dr ...
-
bioRxiv - Genetics 2019Quote: The (Myc-DDK-tagged)-CDK2 cDNA was obtained from Origene (Cat#RC200494). Y15F and Y15F mutant cDNA were generated as described above and transfected into HEK-293T cells (ATCC ...
-
bioRxiv - Immunology 2019Quote: ... SCF and TPO were amplified by PCR from cDNA expression plasmids (Origene) and cloned into pMX retroviral vectors (vectors details in Supplementary Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: The human cDNA clones of LRPPRC and SLIRP were provided by OriGene (product numbers ...
-
bioRxiv - Microbiology 2020Quote: ... the ACE2 coding sequence was amplified from an ACE2 cDNA (Origene Inc) using primers with flanking 5’-XbaI and 3’-SalI sites and cloned into pLenti.CMV.GFP.puro ...
-
bioRxiv - Cancer Biology 2021Quote: ... T192-RFP-3xHA - was generated by subcloning the cDNA of TMEM192 (Origene) together with monomeric Red Fluorescent Protein (mRFP ...
-
bioRxiv - Cell Biology 2020Quote: Mouse Add1 cDNA transcript variant 1 was purchased from Origene (Cat# MR210357). The Add1 gene was amplified and subcloned into pUC19 for point mutations by the GeneArt Site-Directed Mutagenesis Plus Kit (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... prosaposin was amplified from human prosaposin cDNA (pCMV6-XL5-PSAP, Origene, # SC118405), SBP-mCherry and the Str-KDEL_SBP-mCherry-GPI (Addgene # 65295 ...
-
bioRxiv - Biophysics 2022Quote: Human LRRC8A and LRRC8C cDNAs cloned into pCMV6 were purchased from OriGene Technologies ...