Labshake search
Citations for Origene Technologies :
1 - 50 of 182 citations for Two Hybrid cDNA Library since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: The Y2H assay was conducted using the DupLEX-A yeast two-hybrid system (OriGene). The EGY48 yeast strain was transformed with pJG4-5 carrying RK kinase domains or BKNs (prey ...
-
bioRxiv - Neuroscience 2021Quote: ... elegans cDNA library (OriGene) using 5’ AGAGAGAATGATGTTAGGAGG 3’ and 5’ AGTTGAAAATGAAAGAATAATGG 3’ (55°C annealing temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... Validation of the Y2H result was performed by the DupLEX-ATM yeast two-hybrid system (OriGene). Human Piezo2 CTD was cloned into the pEG202NLS vector and fused with LexA ...
-
bioRxiv - Neuroscience 2022Quote: ... the lacZ-reporter gene assay of the DupLex-A yeast-two-hybrid system (Origene, Rockville, MD) was used ...
-
bioRxiv - Cell Biology 2019Quote: ... and PAK2 were amplified from cDNA library (Jurkat cells, Origene) by PCR ...
-
bioRxiv - Cell Biology 2020Quote: ... the gene for NPM was amplified from cDNA library (Jurkat cells, Origene) by PCR and inserted to vectors peGFP-C2 and pmRFP1-C2 (originally Clontech) ...
-
bioRxiv - Microbiology 2021Quote: ... Human cDNA (Origene) of NgR1 (NM_023004) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized using the first-strand cDNA synthesis kit (Origene) with 1 μg of total RNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and two Stealth siRNAs targeting ELP3 (ELP3 siRNA1(OriGene#SR310519A) and ELP3 siRNA 2 (OriGene#SR310519B) ...
-
bioRxiv - Cancer Biology 2020Quote: ... of the two shHIP1 constructs (Origene, HuSH pRS plasmids #TR312457) in PNT1A and DU145 followed by selection with 2.0μg/ml final concentration of Puromycin (Sigma #P9620 ...
-
bioRxiv - Immunology 2021Quote: ... The cDNA coding for FcγRI was amplified from the NM_000566 cDNA (Origene) with the following primers ...
-
bioRxiv - Cell Biology 2021Quote: Mouse Igfbp3 cDNA (Origene) was amplified with attB-containing primers and cloned into pDONR 221 (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... Ncaph2 cDNA (Origene, MC200537) and the eGFP ORF in the pUC19 vector.
-
bioRxiv - Neuroscience 2023Quote: ... cDNAs (Origene #RC209565, #RC215868) were cloned into an AAV-expression vector downstream of the hSyn promotor ...
-
bioRxiv - Biochemistry 2023Quote: ... two gRNA vectors and one linear donor were obtained from OriGene Technologies (KN405837) ...
-
bioRxiv - Cell Biology 2022Quote: ... Extracted RNA was converted to cDNA using the First Strand cDNA Synthesis kit (Origene) and then subjected to real time quantitative PCR using SYBR Green Master mix (BioRad ...
-
bioRxiv - Cell Biology 2023Quote: ... two different anti-human DSG2 antibodies (DSG2-Origene, #BM5016; DSG2-Abcam, #ab14415) were used at 1:1000 dilutions in blocking buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... human FBXO38 cDNA (Origene #RC204380) was cloned into pcDNA3.1 containing N-terminal twinStrepII- FLAG-tag (NSF) ...
-
bioRxiv - Biochemistry 2023Quote: ... or control cDNA (Origene PS100093) was mixed with packaging plasmids MD2G (1 μg ...
-
bioRxiv - Genomics 2021Quote: ... the CTCF cDNA was amplified from a pCMV6-Entry vector containing CTCF cDNA (Origene, RC202416), the AID-eGFP-2A-bls was amplified from pEN244-CTCF-AID[71-114]-eGFP-FRT-Blast-FRT (gift of Elphege Nora ...
-
bioRxiv - Developmental Biology 2021Quote: Full length Cnot3 cDNA (OriGene, USA) was cloned in pCDNA 3.2/V5/GW/D-TOPO by PCR addition of restriction sites SmaI/NotI following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... IL11 cDNA was purchased from Origene and cloned into pBabe-puro ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was obtained from OriGene (RC209922) and a C-terminal FLAG-tag was added ...
-
bioRxiv - Cancer Biology 2020Quote: ... CXCR4 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: SLFN11 cDNA (OriGene Technologies Cat# RC226247L4) and the pVector control vector (OriGene Technologies Cat# PS100093 ...
-
bioRxiv - Neuroscience 2023Quote: The human GPR37L1 cDNA clone (Origene) was subcloned into pcDNA3.1+ (Invitrogen ...
-
bioRxiv - Physiology 2023Quote: Human SLC8B1 cDNA (Origene #RC214624; NM_024959) was PCR amplified using primers to introduce a 5′ AgeI restriction site and a 3′ BamHI restriction site flanking the coding sequence ...
-
bioRxiv - Cell Biology 2023Quote: ... TissueScanTM Tumour cDNA arrays from OriGene Technologies ...
-
bioRxiv - Cancer Biology 2019Quote: ... TCF4 cDNA (Origene, Cat# 224345, Rockville, MD) was cloned into pLenti4/V5-Dest expression vector (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... Human Plaat cDNAs were purchased from ORIGENE [RC208444 for PLAAT1 (NM_020386) ...
-
bioRxiv - Neuroscience 2021Quote: Human cDNA panels were obtained from Origene: TissueScan ...
-
bioRxiv - Neuroscience 2021Quote: hFIBCD1 cDNA was ordered from Origene (#RC206180) and sub-cloned by Gateway cloning (Thermo ...
-
bioRxiv - Neuroscience 2021Quote: ... 1N3R or 2N3R MAPT cDNA vector (Origene), and after 48 hours were either fixed with 10% formalin (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2021Quote: ... Human ERβ cDNA was obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Biophysics 2020Quote: ... or ANXA5 cDNA were purchased from OriGene Technologies.
-
bioRxiv - Cancer Biology 2019Quote: TAOK3 full length cDNA was purchased from Origene. We used the gateway system to transfer TAOK3 into a lentiviral-based expression vector ...
-
bioRxiv - Neuroscience 2021Quote: ... and cDNA encoding human TTL (NP_714923, Origene #RC207805L2) was cloned in it for TTL expression ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human RIOK2-flag cDNAs encoding isoform I (Origene) were cloned into pRev-Tre tetracycline inducible vectors (Clontech) ...
-
bioRxiv - Biophysics 2020Quote: ... MICU2 and EMRE cDNAs were purchased from Origene Technologies USA ...
-
bioRxiv - Neuroscience 2020Quote: The cDNA sequence of human GAPDH (OriGene, UK) was inserted into the pET-28b(+ ...
-
bioRxiv - Cancer Biology 2020Quote: ... TFE3 variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... human VDR transcript variant 2 cDNA (OriGene, RC519628) was transfected into the SKOV3 cells using Lipofectamine 2000TM (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of expression clone cDNA (Origene NM_001923) or control cDNA (Origene PS100093 ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... the following cDNA clones were purchased from Origene: pCMV6-Chpt1 (RefSeq NM_144807) ...
-
bioRxiv - Genomics 2022Quote: ... Zfp281 cDNA was obtained from OriGene (Cat. MC205914) and Foxd2 cDNA was reverse transcribed from RNA obtained from long-term iEP cells.
-
bioRxiv - Neuroscience 2023Quote: Mouse HAPLN1 cDNA was purchased (Origene, Rockville, MD) and cloned as a fusion to Venus into the pCAGGS mammalian expression plasmid ...
-
bioRxiv - Cell Biology 2020Quote: ... or FLAG-mNUP153 (mouse) expression vectors were constructed by amplifying full length human NUP153 or mouse NUP153 cDNA using human NUP153 cDNA (Origene, SC116943) or mouse NUP143 cDNA (ATCC ...
-
bioRxiv - Physiology 2023Quote: ... containing the CMV promoter in front of the human FHF2-VY cDNA (NCBI Reference Sequence NM_001139500, full-length cDNA clone purchased from Origene, Rockville, MD) silently mutated in the sequence targeted by the FHF2 shRNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... the transgenic LGALS1 KD BTSCs were generated via lentivirus carrying two different LGALS1 shRNA plasmids (OriGene, #TL311756). LGALS1 KD BTSC73 lines were established by antibiotic selection (0.5 μg/mL puromycin) ...
-
bioRxiv - Cell Biology 2020Quote: ATG9b cDNA was purchased from Origene (catalog number MR217776) and was sub-cloned into pCMV10-3xFLAG and pEGFP vectors ...