Labshake search
Citations for Origene Technologies :
601 - 650 of 1832 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: Mouse RBM3 gene from RBM3-PUC plasmid (Origene MC203679) was cloned into pMIG-GFP plasmid by restriction digestion method using Bgl2 and EcoR1 (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... rabbit polyclonal anti-GFP (Origene, #TP401) and mouse monoclonal anti-GFP (clone B-2 ...
-
bioRxiv - Biochemistry 2023Quote: ... mature 3T3-L1 adipocytes were transfected with FXN shRNA scramble shRNA (Origene, Rockville, MD, USA), using LipofectamineTM 2000 transfection reagent (ThermoFisher ...
-
bioRxiv - Cell Biology 2023Quote: ... Expression plasmid for OPA1 was purchased from Origene (#SC128155, Rockville, MD, USA), and HA- TAp73 cloned into the pcDNA3 backbone.
-
bioRxiv - Cancer Biology 2023Quote: ... HSPD1 (Origene, #TP760396), or BSA control were coated in PBS with 0.25 ug per well in 96-well ELISA plate (Corning ...
-
bioRxiv - Physiology 2023Quote: Constructs for Fis1 and Drp1 siRNAs were acquired from Origene (Rockville ...
-
bioRxiv - Genetics 2023Quote: ... SMCs were stained with anti-ZC3HC1 (Origene, AP20366PU-N, 1:100), anti-Tubulin (abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... using a cDNA containing human MSI2 obtained from OriGene (Rockville, MD) as a template ...
-
bioRxiv - Neuroscience 2023Quote: ... tRFP (OriGene, TA150061, 1:250), GRIA1 (Alomone ...
-
bioRxiv - Cell Biology 2023Quote: ... pGFP-C-shLenti scrambled negative control (TR30021), and pGFP-C-shLenti Lphn3 shRNA-D (GTATGTTGGCTTCGCCTTGACACCTACTT, custom) were purchased from Origene.
-
bioRxiv - Cell Biology 2023Quote: ... and GFP tagged plasmid with JPh44 translating region (GFP-Δ(1-240) JPh1) were created by OriGene Technologies (Rockville ...
-
bioRxiv - Plant Biology 2023Quote: ... overnight at 4°C (anti-PsbA; AS05 084A; anti-PsaB; AS10 695; anti-APC; AS08 277; Agrisera, anti-His tag; TA150087; OriGene). The membrane was washed 3 times in TBST-T at room temperature for 15 minutes each wash followed by incubation with secondary polyclonal anti-rabbit antisera HRP for one hour at room temperature in TBS-T (Jackson ImmunoResearch ...
-
bioRxiv - Physiology 2023Quote: ... PGC1α or HNF4α overexpression was induced using plasmids from Addgene as gifts from Toren Finkel (#10974)31 and Gerhart Ryffel (#31100).32 QPRT plasmid was purchased from Origene (RC202960). Plasmids were transfected using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary monoclonal antibodies included mouse anti-human ACE2 (1:1500) (Origene, Rockland, Maryland), rabbit anti-human (1:1000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... biosensors were exposed to recombinant Arc protein (TP304129, OriGene) solution in the assay buffer at a concentration of 30 µg mL-1 of for 130 s ...
-
bioRxiv - Cancer Biology 2023Quote: pCMV6-AC-GFP was purchased from (Origene, RG204129). pHAGE-CMV-eGFP (Addgene #196046) ...
-
bioRxiv - Cancer Biology 2023Quote: ... under gentle agitation and incubated overnight with antibodies against Arc/Arg3.1 (TA349500, OriGene), CD9 (ab236630 ...
-
bioRxiv - Cancer Biology 2023Quote: ... together with expression vectors coding for BNC1 (pLenti-BNC1) and/or IRF6 (pCMV6-XL4-IRF6, Origene, SC116274), or their empty counterparts (pLenti-Empty ...
-
bioRxiv - Immunology 2023Quote: ... CDS of IRF8 from IRF8 human tagged ORF clone (RG217646, Origene) were cloned and digested with BamHD1 and XhoI ...
-
bioRxiv - Immunology 2023Quote: ... Mouse anti ZFP36 (Origene #OTI3D10, 2μg/ml), rabbit anti ZFP36L1 (CST #BRF1/2 ...
-
bioRxiv - Immunology 2023Quote: ... or pX459M2-CAPN14g3 using Viromer (Origene) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse Pla2g2a-Myc-DDK construct was obtained from Origene (m-sPLA2-IIA-myc). Mouse PGRN construct was cloned into pSecTag2B vector (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... the KPNB1 coding sequence was PCR amplified from the KPNB1 ORF clone plasmid (Origene, cat# RC200659) and XbaI and BamHI restriction sites were added to the ends of the fragment ...
-
bioRxiv - Cell Biology 2023Quote: ... which were stably transfected with the human PML-VI gene (RC220236, OriGene, Rockville, MD), were selected using neomycin and were designated as HEKPML cells [34] ...
-
bioRxiv - Bioengineering 2023Quote: ... CMV-mSmn1 CDS expression cassette (ORIGENE MR203917) was sub-cloned into pAAV-SMN1-HITI.
-
bioRxiv - Cell Biology 2023Quote: ... A plasmid containing human APOE3-TurboGFP was purchased from Origene (Cat# RG200395). The APOE3 ORF was amplified from APOE3-TurboGFP and subcloned into an mEmerald-N1 backbone via Gibson assembly using HiFi DNA Assembly Master mix (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... ATAGAGCGTGCGGATAATGACAAGGAGTA), Synaptojanin 2 shRNA in pRFP-C-RS vector (cat. no. FI732825, TGTGCCTCTGCGGCAGCACCAGGTGAACT and FI732826, TTGTGGAGACAGAGCAGGCGATTTACATG) were purchased from Origene. Constructs of the following proteins were kind gifts ...
-
bioRxiv - Cancer Biology 2023Quote: ... or their empty counterparts (pLenti-Empty; pCMV6-XL4-IRF6, Origene, PCMV6XL4). After 48 hours ...
-
bioRxiv - Bioengineering 2023Quote: ... Alpha Tubulin (TUBA4A) mouse monoclonal antibody (Origene) and MUC5AC monoclonal antibody (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK cells were co-transfected with human flag-tagged PP1R6 (Origene) and His6-tagged VASP (Benz et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... and pCMV6 Entry Vector plasmid (pCMV6-EV) (catalog #: PS100001) were obtained from Origene. The human GABAA receptor α1 subunit missense mutations (S76R ...
-
bioRxiv - Cell Biology 2023Quote: ... The MCCs were treated with IL-1β (10ng/ml, 50ng/ml, 100ng/ml, TP750014, ORIGENE) for 24 hours.
-
bioRxiv - Cell Biology 2023Quote: ... and IL-1β (10000 ng/ml, TP750014, ORIGENE) injected the right cavity of TMJ respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... Golgin-45-HA-MAO was generated by >90% of the cell population was further confirmed through flow Gibson assembly using the HA-MAO vector digested with NheI/KpnI and golgin-45 cDNA (missing its C-ter, amino acids 1 to 368) purchased from Origene.
-
bioRxiv - Cancer Biology 2023Quote: ... A sample of human CRC hepatic metastasis (#CB522586, 44 years old male) with clear tumor-liver borders was selected from a commercial biobank (Origene). Non-consecutive sections were cut with a thickness of 10μm and placed onto 2 capture areas of 10X Visium Spatial Gene expression slide using a cryostat (Leica CM3050S) ...
-
bioRxiv - Cancer Biology 2023Quote: ... or shRNA negative control (Origene, cat.#TR30021) and using the adequate drug for cell selection ...
-
bioRxiv - Cancer Biology 2023Quote: ... or shScramble sequence as control (OriGene, cat.#TR30021). Constructs co-expressed GFP ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stable cell lines were stablished transducing cells with a set of 4 shRNAs against Mdm2 (Origene, cat.#TL311529) or shRNA negative control (Origene ...
-
bioRxiv - Cancer Biology 2023Quote: ... or shRNA negative control (OriGene, cat.#TR30033), and using the appropriate drug for cell selection.
-
bioRxiv - Cancer Biology 2023Quote: Cells expressing shMdm2 or shScramble were sorted for GFP positive cells and transduced with lentivirus carrying a pool of shRNAs against Sprouty4 (4 different shRNAs purchased from OriGene, cat.#HC108594) or shScramble sequence as control (OriGene ...
-
bioRxiv - Cancer Biology 2023Quote: ... HT1080 p53KO cells were transduced with lentivirus carrying a pool of shRNAs against Mdm2 (4 different shRNAs purchased from OriGene, cat.#TL311529) or shScramble sequence as control (OriGene ...
-
bioRxiv - Cancer Biology 2023Quote: ... or shScramble sequence as control (OriGene, cat.#TR30033). Constructs co-expressed RFP ...
-
bioRxiv - Cancer Biology 2023Quote: ... Both were inserted into pCMV6-AN-HA (Origene, #PS100013) and the correct sequence confirmed by sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: The following antibodies were used for western blotting: PRR14L (Origene, Rockville, MD; TA331394), HA (Proteintech ...
-
bioRxiv - Cancer Biology 2023Quote: ... containing the Tantalus domain and SLiM sequence by PCR amplification of the required coding region with insertion into pCMV6-AC-Myc-DDK (Origene, Rockville, MD, USA) using an In-Fusion HD Cloning Plus kit (Takara Bio ...
-
bioRxiv - Cancer Biology 2023Quote: ... gRNAs were obtained from Integrated DNA technology as two single strand oligos and annealed in 40 μl of annealing buffer (Origene, #GE100007) with 2 μl of each oligo (100 μM ...
-
bioRxiv - Genomics 2023Quote: Two biological replicates of HMLE cells were UV crosslinked and iCLIP was performed as previously described using anti-hnRNPM antibody (Origene).
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies used were hnRNPM (Origene technologies, TA301557, 1:50,000), GAPDH (EMD Millipore ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-GFP (catalog#TA150041, OriGene, Rockville, MD) at 1:1000 dilution ...
-
bioRxiv - Biochemistry 2023Quote: ... PCR was performed using the human CYP4F2-myc-DDK (OriGene RC216427) plasmid (Forward primer ...