Labshake search
Citations for Origene Technologies :
801 - 850 of 1832 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... using NKG2D and Ly49A cDNA clone expression vectors (Origene). NKG2D-S/L were generated by PCR using forward 5’ TAGTAGTCTCGAGCCACCATGAGCAAATGCCATAATTACGACCTC 3’ (short isoform ...
-
bioRxiv - Cancer Biology 2022Quote: Western blot antibodies for GOT2 detection were rabbit anti-human GOT-2 polyclonal antibody (Origene, catalog #TA325088) and HRP-conjugated AffiniPure Goat anti-rabbit IgG (ThermoFisher ...
-
bioRxiv - Cancer Biology 2022Quote: A plasmid containing the hAHRWT sequence was purchased from Origene (RC209832). The Q383H point mutation was introduced with site-directed mutagenesis with forward primer cattgtaactcacagaccactaacagatg and reverse primer gttagtggtctgtgagttacaatgatataatc ...
-
bioRxiv - Neuroscience 2022Quote: ... was purchased from OriGene Technologies Inc (Cat ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-RFP (1:1000, OriGene, AP09229PU-N), guinea pig anti-pSmad1/5/8 (1:300 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... PCMV6-XL6 vector (Origene) was used as a negativecontrol ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... CAMK2A in dcSSc fibroblasts was overexpressed using CAMK2A vectors from Origene. 0.1 μg/ml of CAMK2A vector was mixed with Lipofectamine 2000 ...
-
bioRxiv - Biophysics 2022Quote: Transfection of cells was performed transiently with plasmid DNA using Turbofectin 8.0 (PN: TF81001, Origene), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-desmoglein-2 mouse monoclonal (Origene, Rockville, MD, USA), anti-E-cadherin mouse monoclonal (BD ...
-
bioRxiv - Cell Biology 2022Quote: ... Transfer plasmid containing the A20 insert was obtained from Origene (MR210582L4 ...
-
bioRxiv - Cell Biology 2022Quote: ... Transfer plasmid containing the A20 insert was obtained from Origene (MR210582L4, Tnfaip3 NM_009397, OriGene Technologies, Inc.MD, USA). Packaging (psPAX2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The ORF encoding Fgfr2iiib (Origene; MC221076), the IRES sequence from pLVX-IRES-Puro (Clontech ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... MICAL-L1 (Origene, RG214051); and DENNd1c (Origene ...
-
bioRxiv - Developmental Biology 2022Quote: ... sections were boiled in 1× citrate buffer (ORIGENE, ZLI-9064) and then microwaved at low power for 15 minutes ...
-
bioRxiv - Developmental Biology 2022Quote: ... the slides were incubated with goat anti-rabbit IgG conjugated to horseradish peroxidase (HRP) (ORIGENE, ZB-2301) at RT for 1 h ...
-
bioRxiv - Immunology 2022Quote: ... Plasmid containing human IL-12p35 cDNAs were obtained from Origene. One day before transfection ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 CIC OE cells were developed using CIC-Myc-tag plasmid purchased from Origene (CAT#: RC215209). Geneticin (250μg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... pCMV-CIC with myc-tag was purchased from Origene and validated previously.
-
bioRxiv - Molecular Biology 2022Quote: ... The plasmid pCMV6-WSB2 (NM_018639.3) was purchased from OriGene. Loss-of-function MT DDB2 (WDΔ238-278) ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-ANP32E (OriGene, TA351339), anti-H3 (Abcam ...
-
bioRxiv - Cell Biology 2022Quote: ... and pCMV6 Entry Vector plasmid (pCMV6-EV) were obtained from Origene. The human FLAG-tagged EMC3 plasmid was purchased from GenScript (catalog # ...
-
bioRxiv - Cell Biology 2022Quote: ... respectively (Origene Technologies) and selection in Puromycin ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-tGFP (1:1000 Origene, TA150041) GAPDH (1:2000 Millipore ...
-
bioRxiv - Molecular Biology 2022Quote: ... tGFP (1:200 Origene, TA150041), ki67 (Medac 275R-18) ...
-
bioRxiv - Neuroscience 2022Quote: A plasmid encoding human TrkB was purchased from OriGene Technologies ...
-
bioRxiv - Immunology 2022Quote: ... ITPRIPL1 (TA336137, Origene), Flag-tag (4793 ...
-
bioRxiv - Microbiology 2022Quote: ... were coated with various concentrations of purified recombinant caspase-4 (Origene, TP760359) overnight at 4°C ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... and DENNd1c (Origene, RC206410);
-
bioRxiv - Neuroscience 2022Quote: Short interference mouse PCBP1 RNAi plasmids were purchased from Origene (TL502540). Lentiviral particles expressing the PCBP1 shRNAi or scramble control were produced by the VirusTech Core Facility ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA fragments were cloned into pLenti plasmid (Origene) (EcoRI and PspXI) ...
-
bioRxiv - Physiology 2022Quote: CRISPR-Cas9 Genome editing was used to generate a homozygous knockout of STK25 in WTC iPSCs following the manufacturer’s protocol (ORIGENE) with gRNA vector (KN203215G) ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were transiently transfected with control siRNA duplex (OriGene #SR30002) and two Stealth siRNAs targeting ELP3 (ELP3 siRNA1(OriGene#SR310519A ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: The pCMV6-Ntrk2-Myc-DDK (FLAG) plasmid (MR226130) was purchased from OriGene Biotechnologies (Rockville ...
-
bioRxiv - Cell Biology 2022Quote: ... FGFR2-flag recombinant protein (Origene, Rockville, MD, USA) was added to the plate for adherence to the coated binding candidates ...
-
bioRxiv - Cancer Biology 2022Quote: ... pCMV6-FLAG-CD44 (OriGene) and pCMV3-HA-CD81 (Sino Biological ...
-
bioRxiv - Cell Biology 2022Quote: The full length of human PCDH15-CD1-1 (Q99PJ1, uniport) cloned in pcDNA3.1 was obtained from OriGene. PCDH15-CD2 (Q99PJ1-10 ...
-
bioRxiv - Biochemistry 2022Quote: Lentiviral pGFP-shHKII vector encoding human shRNAHKII (Cat# TL312415) and non-silencing control pGFP-C-shLenti vector (Cat#: TR30023) were purchased from OriGene Technologies Inc (Rockville ...
-
bioRxiv - Biochemistry 2022Quote: ... Rb mAb to UBE2D2 (Origene Cat#TA806600), Rb mAb to UBE2D3 (Abcam ab176568) ...
-
bioRxiv - Bioengineering 2022Quote: ... or a lysate control (Origene LY500001), was spiked in as a competitor between replicate arrays ...
-
bioRxiv - Bioengineering 2022Quote: ... or HEK293T overexpressing HER2 (Origene LY417979) lysates were used as controls ...
-
bioRxiv - Bioengineering 2022Quote: ... Wild-type HEK293T lysate (Origene LY500001) or HEK293T overexpressing HER2 (Origene LY417979 ...
-
bioRxiv - Bioengineering 2022Quote: Anti-HER2 monoclonal antibodies were used as primary antibodies in a series of Western Blots on cellular lysates of wild-type HEK293T (non-expressing HER2) cells (Origene LY500001) and HEK293T overexpressing HER2 (Origene LY417979) ...
-
bioRxiv - Bioengineering 2022Quote: ... RM228 (Origene TA352727); QO3B (Creative Diagnostics DCABH-2987) ...
-
bioRxiv - Bioengineering 2022Quote: ... A 1:60 dilution of HER2 expressing whole cell lysate in RIPA buffer (Origene LY417979), or a lysate control (Origene LY500001) ...
-
bioRxiv - Bioengineering 2022Quote: ... and HEK293T overexpressing HER2 (Origene LY417979). Lysates were directly loaded into each lane and Beta-Actin was used as a normalization control ...
-
bioRxiv - Physiology 2022Quote: Recombinant protein STK25 (0.5μM, TP303215, OriGene) and PRKAR1A (1μM ...
-
bioRxiv - Physiology 2022Quote: ... and PRKAR1A (1μM, TP303828 Origene) were mixed with in vitro kinase buffer (25mM Tris-HCl ...
-
bioRxiv - Biochemistry 2022Quote: D-cysteine transport experiments were performed in HEK293 cells transiently transfected with human SLC1A15 (ASCT2; Origene; Cat# RC200305) and rat SLC7A10 (Asc1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and two Stealth siRNAs targeting ELP3 (ELP3 siRNA1(OriGene#SR310519A) and ELP3 siRNA 2 (OriGene#SR310519B) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and ELP3 siRNA 2 (OriGene#SR310519B)) or with pcDNA 4/T0 derivative plasmid expressing canonical ELP3 (pcDNA 4/T0-ELP3) ...