Labshake search
Citations for Origene Technologies :
1 - 50 of 1762 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: The DNAJ cDNA (corresponding to residues 4316-4420 of sacsin) was subcloned using mouse pEGFP-sacsin full length cDNA (OriGene Technologies, Rockville, MD, USA) and inserted in frame with GST into the pGEX6 vector ...
-
bioRxiv - Developmental Biology 2024Quote: ... We used pCMV6-AC-GFP Mammalian Expression Vector (ORIGENE, PS100010) as control vehicle plasmids.
-
bioRxiv - Cell Biology 2024Quote: ... and mouse anti-BTN3A2 antibodies (ORIGENE, USA, #CF500730, 1:50), respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... The scrambled shRNA and IP3R1 shRNA plasmids were purchased from OriGene; the 29mer sequence of scrambled shRNA (Cat# TR30015 ...
-
bioRxiv - Immunology 2024Quote: ... C-terminal flag-tagged ZFP36L2 (Origene) was cloned into the pMIG-W vector (67 ...
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... then incubation was undertaken with a primary rabbit polyclonal CSF2RA (GM-CSF receptor alpha) antibody for 1 hour (Origene TA323990S ...
-
bioRxiv - Genetics 2024Quote: ... anti-DNA-PK (1:4000, Origene #TA314389), anti-Rabbit-IgG (1:2000 ...
-
bioRxiv - Genomics 2024Quote: Knock-out was performed using the TDG mouse Gene Knock-Out kit (Origene, KN317363). This kit contained two gRNAs that targeted the first exon of TDG gene and a donor vector that contained a GFP-Puromycin cassette to facilitate the screening process ...
-
bioRxiv - Developmental Biology 2024Quote: ... Lmx1b Mouse Tagged ORF Clone plasmids (ORIGENE, MG226016) were transfected using Lipofectamine LTX Reagent with PLUS Reagent (Invitrogen ...
-
bioRxiv - Genomics 2024Quote: ... cells were transfected with 300 ng of each sgRNA-15xPBS plasmid and 40 ng of each fluorescent protein plasmid using 3.5 µL TurboFectin 8.0 (OriGene). Media was changed at 24 hours post-transfection.
-
bioRxiv - Genetics 2024Quote: ... sgRNAs and Cas9 endonuclease (Origene). Each plasmid encoded sgRNA was designed to bind at the indicated locations (Figure 1-figure supplement 1) ...
-
bioRxiv - Genomics 2024Quote: ... R: CCAGGAACTCATACCCACGCTC (Origene, USA). Primers were obtained from previous literature or previously validated in our lab ...
-
bioRxiv - Immunology 2024Quote: mRNA was synthesized encompassing the open reading frame of a fusion protein coding for the full-length ANKRD55 isoform 201 coupled to C-terminal MYC-FLAG tags as provided by a commercial vector (Origene, Cat. No. RC221211). Unmodified synthesized ANKRD55 mRNA transcript was capped at the 5’ end using wild-type bases CleanCap® AG (TriLink BioTechnologies ...
-
bioRxiv - Immunology 2024Quote: ... Individual clones were screened by western blotting with anti-ZFAND6 (Origene; TA335508).
-
bioRxiv - Immunology 2024Quote: ... and ZFAND6 rabbit pAb (Origene Cat# TA335508).
-
bioRxiv - Immunology 2024Quote: ... ZFAND6-Flag-Myc was purchased from Origene. pEBB-HA cIAP1 was a gift from Colin Duckett (Addgene plasmid# 38232 ...
-
bioRxiv - Immunology 2024Quote: ... conditioned media or plasma according to the manufacturer’s instructions (OriGene, USA).
-
bioRxiv - Immunology 2024Quote: ... with recombinant TSP-1 (Origene, USA) at a concentration of 100ng/ml ...
-
bioRxiv - Immunology 2024Quote: ... Both expression vectors were purchased from Origene (OriGene Technologies GmbH).
-
bioRxiv - Immunology 2024Quote: ... Both expression vectors were purchased from Origene (OriGene Technologies GmbH).
-
bioRxiv - Cell Biology 2024Quote: ... and concentrated 20-fold with Lenti Concentrator (OriGene, TR30025), in accordance with the manufacturers’ instructions ...
-
bioRxiv - Bioengineering 2024Quote: Human cryosections from the aorta of a 76-year-old male with atherosclerosis were purchased from OriGene (CAT#: CS611744). Sections were stained as above with minor alterations ...
-
bioRxiv - Pathology 2024Quote: ... The coding sequence for Gremlin-1 (Origene, Cat-No RC210835) was inserted into the plasmid pWPI (kindly provided by Roy Bicknell at University of Birmingham) ...
-
bioRxiv - Cell Biology 2024Quote: ... the following antibodies were used on paraffin sections: RFP (goat, Origene, cat# AB8181-200), RFP (rabbit ...
-
bioRxiv - Immunology 2024Quote: Quantitative PCR (qPCR) was performed on cDNA panels of 48 healthy human tissues (OriGene Technologies, Rockville, MD) and TNBC cell lines using MX3000 (Taqman probes ROPN1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... ETV7 protein (Cat # TP307742) and RUVBL2 (Cat # TP300933) were purchased from Origene.
-
bioRxiv - Neuroscience 2024Quote: ... U251-MG cells were stably transfected with a GFP-tagged YTHDF2 expression plasmid pLenti-C-mGFP-P2A-Puro (OriGene, #RC230306L4) or GFP empty vector by lipofectamine 2000 according to the procedure recommended by the manufacturer ...
-
bioRxiv - Cell Biology 2024Quote: ... pLenti-C-Myc-DDK (RC210158L1; carrying the ORF of human CX36; GJD2; NM_020660) was obtained from Origene (Rockville, Md, USA).
-
bioRxiv - Immunology 2024Quote: ... The number of MT-ATP6 copies per microliter was determined based on a standard curve developed using serial dilutions of a commercially available DNA plasmid (OriGene) with complementary DNA sequences for human MT-ATP6.
-
bioRxiv - Molecular Biology 2024Quote: NSC34 and HEK293T cells were transfected with a plasmid coding for the hnRNPA2B1 (NM_002137) Human Tagged ORF Clone (Origene, RC219318) using Lipofectamine™ 3000 Transfection Reagent (Invitrogen L3000001) ...
-
bioRxiv - Neuroscience 2024Quote: ... The pGFP-A-shAAV shRNA plasmid (Origene, #TR30034) served as the scramble control to produce turbo GFP (tGFP ...
-
bioRxiv - Neuroscience 2024Quote: ... tGFP (turbo GFP, Origene, #TA150075), GAPDH (Meridian Life Science ...
-
bioRxiv - Neuroscience 2024Quote: The pGFP-A-shAAV shRNA cloning plasmids against mouse Gprc6a (Origene, HC141118) were designed for transfection in mouse N2a cells and production for rAAVs ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lactating mammary gland protein butyrophilin (BTN1A1) anti-BTN1A1 (mouse, OriGene Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-GBP1 (Origene) or anti-actin (Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... MA) and antibodies against tdTomato and Ki-67 were obtained from Origene (Rockville, MD) and Abcam (Boston ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary and secondary antibodies were used at the following concentrations: anti-dendra2 1:5000 (OriGene: TA150090), anti-Slack 1:5000 (Aves labs ...
-
bioRxiv - Neuroscience 2024Quote: ... The membranes were incubated with the following primary antibodies overnight at 4°C: mouse anti-DPP9 (Origene, TA503937, 1:1000). After three washes with TBST ...
-
bioRxiv - Molecular Biology 2024Quote: Trastuzumab light chains 1 and 2 were obtained by Tebubio Srl and cloned in the CD81-GFP vector (OriGene, 7268 bp), obtaining the antiHER2 construct (CD81-antiHER2-GFP ...
-
bioRxiv - Molecular Biology 2024Quote: ... TP323680 (Origene) was used as standard ...
-
bioRxiv - Molecular Biology 2024Quote: ... TP762191 (Origene) was used as standard ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified human recombinant NRXN3 TP323448 (Origene) was used as standard ...
-
bioRxiv - Cell Biology 2024Quote: The generation of human cMPL receptor-expressing HEK293-A cells was achieved through a lipofectamine-mediated transfection of a plasmid expressing cMPL and GFP (Origene), previously linearized using the Scal restriction enzyme (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... Lentiviral vectors expressing GFP (TR30021V) or IFI16 fused to monomeric GFP (RC202193L2V) were obtained from OriGene (Rockville, USA).
-
bioRxiv - Microbiology 2024Quote: ... were co-transfected with ORF57 cDNA cloned in pLenti-P2A-Puro Lentiviral Gene Expression Vector (OriGene) together with pCMV.Dr8.2 and pCMV.VSV.G in a ratio of 10:10:3.5 using Lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: Myc-tagged FOS (pCMV6-FOS) expressing vector was purchased from OriGene. The pBAH4 plasmid with point mutations in the ORF57 BS in FOS cDNA was generated by overlapping PCR using a set of primers with mutated BS (oBAH138 and oBAH139 ...
-
bioRxiv - Microbiology 2024Quote: ... seed in a 6-well plate were transiently co-transfected with 200 ng of a myc-tagged FOS (pCMV6-FOS, OriGene, RC202597) and 600 ng of a wt ORF57 (pVM7 ...
-
bioRxiv - Microbiology 2024Quote: ... FOS cDNA under the T7 promoter was used as a template (OriGene). Following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... syntenin (OriGene, TA504796, 1:1000), annexin A1 (Abcam ...
-
bioRxiv - Molecular Biology 2024Quote: ... FLAG-tagged human angiogenin plasmid (hANG) (OriGene, Cat# RC208874) and Mock plasmid were transiently transfected according to the manufacturer’s protocol into HEK293T cells in full growth medium using Lipofectamine 3000 (Thermo Fisher Scientific ...