Labshake search
Citations for Origene Technologies :
51 - 100 of 1762 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... GAPDH (OTI2D9; 1:5,000; Origene), and Actin (JLA20 ...
-
bioRxiv - Neuroscience 2024Quote: ... Louis, MO) (96, the C-terminal HA-tagged ERα was constructed from the purchased ERα cDNA expression clone (Origene #MG227304) into BamHI and EcoRI sites of pcDNA3 vector using PCR amplification ...
-
bioRxiv - Cell Biology 2024Quote: Myc-DDK-tagged ATP6V0A1 expression plasmid (RC226206, Origene, Rockville, MD) for ATP6V0A1 induction and pCMV6-Entry ...
-
bioRxiv - Cell Biology 2024Quote: ... mammalian vector with C-terminal Myc-DDK Tag (PS100001, Origene, Rockville, MD) as control were used ...
-
bioRxiv - Cell Biology 2024Quote: ... TurboFectin 8.0 Transfection Reagent (F81001, Origene, Rockville, MD) was used at a final concentration of 4 μg/ml for transduction ...
-
bioRxiv - Developmental Biology 2024Quote: ... The human full-length Mtss1 expression construct was purchased from Origene (pCMV6-hMtss1, Cat# RC218273, USA), and Myc-tagged Mtss1 deletion constructs (Mtss11I-BAR [amino acids deleted ...
-
bioRxiv - Cell Biology 2024Quote: ... or Nedd4 (Origene, CA, USA, #MR222243) plasmid using Lipofectamine 3000 in serum-free medium for 12 h ...
-
bioRxiv - Bioengineering 2024Quote: ... mouse anti-Lhx1 (CF504527, OriGene, RRID: AB_2724601) labeled with Alexa Fluorphore 647 (Novus ...
-
bioRxiv - Bioengineering 2024Quote: ... and incubated with 5 μg/ml anti-human FcγRIIa (Origene, clone OTI9G5; 5 μg/ml) in blocking solution at 4°C overnight ...
-
bioRxiv - Bioengineering 2024Quote: ... Primary antibodies pan cytokeratin (PanCK, 1:100, OriGene Catalog # CF190032, Lot # F003) and vimentin (VIM ...
-
bioRxiv - Biochemistry 2024Quote: ... and mouse α-PUS7 monoclonal antibody (OriGene, OTI4C6; 1:1,000) followed by goat α-rabbit ...
-
bioRxiv - Biochemistry 2024Quote: ACSS2 expression vector with FLAG tag (NM_018677) was purchased from Origene (Rockville, MD) for mammalian expression ...
-
bioRxiv - Biochemistry 2024Quote: ... CDK2 mouse monoclonal antibody (HRP conjugated) [Clone ID: OTI2D9] (Origene, TA502935BM), monoclonal Anti-FLAG M2-peroxidase (HRP ...
-
bioRxiv - Cell Biology 2024Quote: ... and concentrated 20-fold with Lenti Concentrator (OriGene, TR30025), in accordance with the manufacturers’ instructions ...
-
bioRxiv - Biophysics 2024Quote: ... HEK293T cells were transfected with rat CaMKIIα WT (pCMV6-CaMKIIα-Myc-DDK, #RR201121, Origene), which was generated and sequence-verified by GenScript Biotech (Leiden ...
-
bioRxiv - Biophysics 2024Quote: The commercial clone of full-length human hERG (NM_000238.3) cloned in pCMV6-XL4 (Origene) was subcloned in pmCherry-N1 (Clontech ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by incubation overnight at 4°C with primary antibodies against GFP (1:100, TP401; OriGene Technologies) (Fig 1B) ...
-
bioRxiv - Cell Biology 2024Quote: ... 40 ng/ml bFGF (Origene, TP750002).
-
bioRxiv - Cancer Biology 2024Quote: ... CD98hc overexpression plasmid pCMV6-Myc-DDK was purchased from Origene.
-
bioRxiv - Cancer Biology 2024Quote: ... Some qPCR primers were purchased from Origene (Table S3). Cycle threshold values were normalized to those of the housekeeping genes GAPDH ...
-
bioRxiv - Cell Biology 2024Quote: ... A commercial Cotinine ELISA kit (Origene) suitable for mice was used to quantify blood levels ...
-
Increased dosage of wild-type KRAS protein drives KRAS-mutant lung tumorigenesis and drug resistancebioRxiv - Cancer Biology 2024Quote: The CRISPR-based AAVS1 system for targeted gene insertion into the AAVS1 locus was purchased from Origene (SKU GE100023, SKU GE100024). We cloned the dsRed-IRES-GFP-KRAS-WT-PGK-Hygro and dsRed-IRES-GFP-KRAS-G12V-PGK-Hygro cassettes into the pAAVS1 vector ...
-
bioRxiv - Developmental Biology 2024Quote: ... Lmx1b Mouse Tagged ORF Clone plasmids (ORIGENE, MG226016) were transfected using Lipofectamine LTX Reagent with PLUS Reagent (Invitrogen ...
-
bioRxiv - Developmental Biology 2024Quote: ... We used pCMV6-AC-GFP Mammalian Expression Vector (ORIGENE, PS100010) as control vehicle plasmids.
-
bioRxiv - Cell Biology 2024Quote: The DNAJ cDNA (corresponding to residues 4316-4420 of sacsin) was subcloned using mouse pEGFP-sacsin full length cDNA (OriGene Technologies, Rockville, MD, USA) and inserted in frame with GST into the pGEX6 vector ...
-
bioRxiv - Cell Biology 2024Quote: ... The scrambled shRNA and IP3R1 shRNA plasmids were purchased from OriGene; the 29mer sequence of scrambled shRNA (Cat# TR30015 ...
-
bioRxiv - Cell Biology 2024Quote: ... and mouse anti-BTN3A2 antibodies (ORIGENE, USA, #CF500730, 1:50), respectively ...
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... then incubation was undertaken with a primary rabbit polyclonal CSF2RA (GM-CSF receptor alpha) antibody for 1 hour (Origene TA323990S ...
-
bioRxiv - Genomics 2024Quote: Knock-out was performed using the TDG mouse Gene Knock-Out kit (Origene, KN317363). This kit contained two gRNAs that targeted the first exon of TDG gene and a donor vector that contained a GFP-Puromycin cassette to facilitate the screening process ...
-
bioRxiv - Genetics 2024Quote: ... sgRNAs and Cas9 endonuclease (Origene). Each plasmid encoded sgRNA was designed to bind at the indicated locations (Figure 1-figure supplement 1) ...
-
bioRxiv - Genomics 2024Quote: ... cells were transfected with 300 ng of each sgRNA-15xPBS plasmid and 40 ng of each fluorescent protein plasmid using 3.5 µL TurboFectin 8.0 (OriGene). Media was changed at 24 hours post-transfection.
-
bioRxiv - Genomics 2024Quote: ... R: CCAGGAACTCATACCCACGCTC (Origene, USA). Primers were obtained from previous literature or previously validated in our lab ...
-
bioRxiv - Genetics 2024Quote: ... anti-DNA-PK (1:4000, Origene #TA314389), anti-Rabbit-IgG (1:2000 ...
-
bioRxiv - Immunology 2024Quote: mRNA was synthesized encompassing the open reading frame of a fusion protein coding for the full-length ANKRD55 isoform 201 coupled to C-terminal MYC-FLAG tags as provided by a commercial vector (Origene, Cat. No. RC221211). Unmodified synthesized ANKRD55 mRNA transcript was capped at the 5’ end using wild-type bases CleanCap® AG (TriLink BioTechnologies ...
-
bioRxiv - Immunology 2024Quote: ... Individual clones were screened by western blotting with anti-ZFAND6 (Origene; TA335508).
-
bioRxiv - Immunology 2024Quote: ... and ZFAND6 rabbit pAb (Origene Cat# TA335508).
-
bioRxiv - Immunology 2024Quote: ... ZFAND6-Flag-Myc was purchased from Origene. pEBB-HA cIAP1 was a gift from Colin Duckett (Addgene plasmid# 38232 ...
-
bioRxiv - Immunology 2024Quote: ... conditioned media or plasma according to the manufacturer’s instructions (OriGene, USA).
-
bioRxiv - Immunology 2024Quote: ... with recombinant TSP-1 (Origene, USA) at a concentration of 100ng/ml ...
-
bioRxiv - Immunology 2024Quote: ... C-terminal flag-tagged ZFP36L2 (Origene) was cloned into the pMIG-W vector (67 ...
-
bioRxiv - Microbiology 2024Quote: ... were co-transfected with ORF57 cDNA cloned in pLenti-P2A-Puro Lentiviral Gene Expression Vector (OriGene) together with pCMV.Dr8.2 and pCMV.VSV.G in a ratio of 10:10:3.5 using Lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: Myc-tagged FOS (pCMV6-FOS) expressing vector was purchased from OriGene. The pBAH4 plasmid with point mutations in the ORF57 BS in FOS cDNA was generated by overlapping PCR using a set of primers with mutated BS (oBAH138 and oBAH139 ...
-
bioRxiv - Microbiology 2024Quote: ... seed in a 6-well plate were transiently co-transfected with 200 ng of a myc-tagged FOS (pCMV6-FOS, OriGene, RC202597) and 600 ng of a wt ORF57 (pVM7 ...
-
bioRxiv - Microbiology 2024Quote: ... FOS cDNA under the T7 promoter was used as a template (OriGene). Following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... PFKL and RPIA overexpression was performed using pCMV-PFKL (Origene, SC319353) and pcDNA3.0-RPIA ...
-
bioRxiv - Molecular Biology 2024Quote: ... OGDH F: GGTGTCGTCAATCAGCCTGAGT R: ATCCAGCCAGTGCTTGATGTGC (Origene, UK); PGC1α F ...
-
bioRxiv - Immunology 2024Quote: ... Both expression vectors were purchased from Origene (OriGene Technologies GmbH).
-
bioRxiv - Immunology 2024Quote: ... Both expression vectors were purchased from Origene (OriGene Technologies GmbH).
-
bioRxiv - Cancer Biology 2024Quote: ... CRISPR-KO VPAC2KO Panc02 cells were similarly transduced with VPAC2-overexpression lentiviral particles (Origene) at 50 MOI for the rescue experiment ...
-
bioRxiv - Cancer Biology 2024Quote: ... ZEB1 (Origene, # TA802298) and Slug (Origene ...