Labshake search
Citations for Zymo Research :
301 - 350 of 6307 citations for PCR Product Purification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... After purification with the RNA Clean and Concentrator-5 kit (Zymo Research, Freiburg, Germany), quantity and quality was tested with Nanodrop 2000 (Avantor ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA libraries were purified with Quick-DNA MicroPrep column purification kit (Zymo Research, #D3020). The quality of the libraries was assessed with TapeStation and the DNA contents were quantified by Qubit ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was extracted from these samples using Direct-zol RNA purification kits (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Gel-purification was carried out using the Zymoclean Gel DNA Recovery Kit (Zymo Research). PCR purification was performed using the GenElute PCR Clean-Up Kit (Sigma-Aldrich) ...
-
miRNA activity contributes to accurate RNA splicing in C. elegans intestine and body muscle tissues.bioRxiv - Molecular Biology 2019Quote: The RNA purification was performed using the RNA MiniPrep kit (Zymo Research, cat ZR2070) as per the manufacturers protocol ...
-
bioRxiv - Bioengineering 2020Quote: ... and RNA was isolated using the Direct-zol RNA Purification Kit (Zymo Research, R2060). Genomic DNA was removed using the TURBO DNA-free™ Kit (ThermoFischer ...
-
bioRxiv - Cell Biology 2022Quote: ... Total RNA was further purified using the Direct-zol column purification kit (Zymo, R2050). Reverse transcriptase reactions were carried out using the SuperScript™ III Reverse Transcriptase kit (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: ... and purification of the library using ZymoPURE II Plasmid Gigaprep Kit (Zymo Research, D4204).
-
bioRxiv - Cell Biology 2023Quote: ... and colonies were picked for maxipreps (ZymoPURE II Plasmid Purification Kit, Zymo Research, D4202) and Sanger sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: RNA extraction was performed with the Direct-zol Miniprep RNA Purification Kit (Zymo Research) with on-column DNase treatment ...
-
bioRxiv - Bioengineering 2024Quote: ... followed by purification and enrichment using the RNA Clean and ConcentratorTM kit (R1018, Zymo). The efficiency of the total RNA purification and DNA removal was verified using the NanoDropTM 1000 instrument (Thermo Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... Extraction and purification of DNA was performed using DNA Clean & Concentrator 5-Kit (Zymo) or Maxwell PureFood GMO and Authentication Kit (Promega ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purification of RNA employed the Zymo Directzol RNA micro kit (Zymo Research, Cat# R2060), followed by end repair with T4 Polynucleotide Kinase (T4 PNK ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA products were concentrated using the RNA Clean & Concentrator kit from Zymo (R1015), and 15 μl of sample was resolved in an 8% polyacrylamide gel in the presence of 7M Urea and 3ug/ml ethidium bromide (Figure S2) ...
-
bioRxiv - Genomics 2020Quote: ... The final product was purified with DNA Clean and Concentrator kit (Zymo Research).
-
bioRxiv - Cancer Biology 2020Quote: ... The cDNA products were concentrated using cDNA Clean & Concentrator-5 Kit (Zymo Research) followed bead cleanup using 0.6X AMPure XP Beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting product was purified with the DNA Clean and Concentrator kit (Zymo). Using this product as a template ...
-
bioRxiv - Neuroscience 2022Quote: ... the product was purified with the DNA Clean & Concentrator-5 Kit (Zymo Research). 20 μl tagmented DNA was PCR amplified with NEBNext High-Fidelity PCR Master mix and forward and reverse UDI primers ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The DNase treated products were cleaned with Quick-RNA MiniPrep Kit (Zymo Research), then validated on agarose gel and concentration was measured with Epoch Microplate Spectrophotometer (BioTek Instruments ...
-
bioRxiv - Molecular Biology 2022Quote: ... The product was cleaned up using RNA Clean & Concentrator-5 kit (ZYMO, R1013) and added into 20 μl of reverse transcription and strand-switching reaction containing 100 nM custom primer (5’ - phos/ ACTTGCCTGTCGCTCTATCTTCATTGATGGTGCCTACAG - 3’) ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA products were purified using the DNA Clean & Concentrator-5 Kit (Zymo Research). All purified PCR products were visually checked for expected size via 1% agarose gel electrophoresis and assessed for purity and yield via Nanodrop (Thermo Fisher Scientific).
-
bioRxiv - Genomics 2019Quote: ... The RNA product was purified using the RNA Clean & Concentrator kit (Zymo Research).
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted with the ZymoBIOMICS 96 DNA Kit (Product D4309) from Zymo Research using the manufacturer’s suggested protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... Products were purified with a DNA Clean and Concentrator 5 kit (Zymo Research) and eluted with 6 μl water ...
-
bioRxiv - Genetics 2023Quote: ... the products were purified by an RNA Clean & Concentration-5 kit (Zymo Research), followed by 5′ phosphorylation (39 μl RNA ...
-
bioRxiv - Genetics 2023Quote: ... reaction products were purified by an RNA Clean & Concentrator-5 kit (Zymo Research), followed by 5′ phosphorylation (New England BioLabs) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and the products were purified using the DNA Clean & Concentrator kit (Zymo Research). For the next-generation sequencing (NGS) ...
-
bioRxiv - Systems Biology 2020Quote: ... 2 μL of PCR products from each well were pooled and purified using the DNA Clean & Concentrator (Zymo) and eluted in water ...
-
bioRxiv - Systems Biology 2023Quote: ... 2 μL of PCR products from each well were pooled and purified using the DNA Clean & Concentrator (Zymo) and eluted in water ...
-
bioRxiv - Biophysics 2023Quote: ... followed by purification using DNA clean and concentrator spin-column purification (Zymo). RNA was transcribed using IVT as described above ...
-
bioRxiv - Molecular Biology 2020Quote: ... Column purification (Zymo #D4013) and ×0.5 volume of AMpure beads (Beckman Coulter ...
-
bioRxiv - Genomics 2020Quote: ... After column purification of the reaction using the DNA Clean and Concentrator-5 kit (Zymo), we transformed it into 10beta electrocom petent cells (NEB) ...
-
bioRxiv - Developmental Biology 2019Quote: ... The amplified ATAC libraries were purified using a DNA purification kit (Zymo Research, Cat#D4003) and size selected using Agencourt AMPure beads (Beckman Coulter ...
-
bioRxiv - Plant Biology 2019Quote: ... Purification of ChIP DNA was carried out with the Clean and Concentrator kit (Zymo Research). Libraries were constructed using 1:20 diluted adaptor from Kapa Biosystems Hyper Library Construction Kit and 10 cycles of DNA amplification ...
-
bioRxiv - Molecular Biology 2021Quote: ... The biotinylated probes were purified using the RNA Clean & Concentration -5 purification kit (Zymo R1013).
-
bioRxiv - Bioengineering 2020Quote: ... Purification of mRNA was performed using the RNA Clean and Concentrator Kit (Zymo Research R1017). gRNA was stored at −80°C immediately after measuring concentration and diluting to 130 μM.
-
bioRxiv - Plant Biology 2021Quote: ... genomic DNA was isolated from ten pooled seedlings using the Quick DNA purification kit (Zymo), and library preparation and sequencing was performed by BGI Genomics (Hong Kong) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Libraries from the gel were purified using a Gel Purification Kit (Zymo, #D4002, Irvine, CA) as described by the manufacturer ...
-
bioRxiv - Systems Biology 2022Quote: ... followed by purification and enrichment using the RNA Clean and Concentrator™ kit (R1018, Zymo). The efficiency of the total RNA purification and DNA removal was verified using the NanoDrop™ 1000 instrument (Thermo Scientific ...
-
bioRxiv - Systems Biology 2022Quote: ... RNA extraction and purification was performed using the DirectZol® RNA Minprep Plus Kit (Zymo). Extracted RNA was stored at −80 °C.
-
bioRxiv - Molecular Biology 2021Quote: ... Purification of mRNA was performed using the RNA Clean and Concentrator Kit (Zymo Research R1017). gRNA was stored at −80C immediately after measuring concentration and diluting to 130 μM.
-
bioRxiv - Molecular Biology 2020Quote: ... RNA isolation and purification were performed using the Quick – RNA™ MicroPrep kit (Zymo Research), according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... bisulfite conversion and purification was carried out using the EZ Methylation Direct MagPrep kit (Zymo), following the manufacturers’ instructions but with half volumes ...
-
bioRxiv - Molecular Biology 2023Quote: ... was prepared for total RNA purification using the Direct-zol RNA Miniprep kits from Zymo Research ...
-
bioRxiv - Developmental Biology 2023Quote: ... followed by a purification using the Zymoclean Gel DNA Recovery Kit (Zymo Research, Irvine, CA). The libraries were sequenced at the Vanderbilt Technologies for Advanced Genomics using a NovaSeq 6000 System (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... followed by purification using Zymo DNA Clean and Concentrator-5 kit (Zymo Research, cat# D4013). A purified ...
-
bioRxiv - Genomics 2023Quote: ... Homogenate was purified using the Direct-zol® RNA Purification Kit (Zymo Research, Irvine, CA) and genomic DNA was removed using the Turbo DNase Kit (Invitrogen ...
-
bioRxiv - Pathology 2023Quote: ... followed by purification using a Direct-zol RNA microprep kit (Zymo Research, Irvine, CA, USA) with on-column DNAse treatment ...
-
bioRxiv - Microbiology 2024Quote: ... The three PCR fragments were purified (Zymo kit) and used in a 1:1:1 molar ratio Golden Gate assembly reaction with AarI (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... The three PCR fragments were purified (Zymo kit) and used in a 1:1:1 molar ratio Golden Gate assembly reaction with AarI (ThermoFisher ...